ID: 1011270484

View in Genome Browser
Species Human (GRCh38)
Location 6:85573778-85573800
Sequence AAAATCTGGTAGTACACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011270482_1011270484 -7 Left 1011270482 6:85573762-85573784 CCAGAACTATTCAATCAAAATCT 0: 1
1: 1
2: 17
3: 151
4: 998
Right 1011270484 6:85573778-85573800 AAAATCTGGTAGTACACCCCAGG No data
1011270481_1011270484 -6 Left 1011270481 6:85573761-85573783 CCCAGAACTATTCAATCAAAATC 0: 1
1: 1
2: 8
3: 165
4: 933
Right 1011270484 6:85573778-85573800 AAAATCTGGTAGTACACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011270484 Original CRISPR AAAATCTGGTAGTACACCCC AGG Intronic
No off target data available for this crispr