ID: 1011273834

View in Genome Browser
Species Human (GRCh38)
Location 6:85607999-85608021
Sequence GCTAAAACCCACAAATATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011273832_1011273834 -1 Left 1011273832 6:85607977-85607999 CCAAGAAATCCTAGGGGTATAAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1011273834 6:85607999-85608021 GCTAAAACCCACAAATATATTGG 0: 1
1: 0
2: 0
3: 27
4: 183
1011273830_1011273834 5 Left 1011273830 6:85607971-85607993 CCGCAACCAAGAAATCCTAGGGG 0: 1
1: 0
2: 1
3: 18
4: 153
Right 1011273834 6:85607999-85608021 GCTAAAACCCACAAATATATTGG 0: 1
1: 0
2: 0
3: 27
4: 183
1011273833_1011273834 -10 Left 1011273833 6:85607986-85608008 CCTAGGGGTATAAGCTAAAACCC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1011273834 6:85607999-85608021 GCTAAAACCCACAAATATATTGG 0: 1
1: 0
2: 0
3: 27
4: 183
1011273826_1011273834 20 Left 1011273826 6:85607956-85607978 CCAAAACTGCTCGTCCCGCAACC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1011273834 6:85607999-85608021 GCTAAAACCCACAAATATATTGG 0: 1
1: 0
2: 0
3: 27
4: 183
1011273828_1011273834 6 Left 1011273828 6:85607970-85607992 CCCGCAACCAAGAAATCCTAGGG 0: 1
1: 0
2: 2
3: 8
4: 127
Right 1011273834 6:85607999-85608021 GCTAAAACCCACAAATATATTGG 0: 1
1: 0
2: 0
3: 27
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011273834 Original CRISPR GCTAAAACCCACAAATATAT TGG Intronic
901866866 1:12112091-12112113 TCAAAAACCCACAAACATAAGGG - Intronic
906923942 1:50094290-50094312 AACAAAACCCACAAATTTATAGG - Intronic
909336108 1:74475874-74475896 TGTAAAAACCACAAATATAAAGG + Intronic
909586598 1:77296710-77296732 GCTTTAACCTACTAATATATGGG - Intronic
911022195 1:93400274-93400296 TCAATAACCCACAAATTTATAGG + Intergenic
912113938 1:106380356-106380378 GATAAAACTCACAAAAATGTGGG + Intergenic
913122879 1:115757733-115757755 GCTTAATCCCACCAAAATATGGG - Intronic
915224858 1:154404956-154404978 CCTAAAACCCACCAATGTCTGGG - Intergenic
916002242 1:160628218-160628240 ACTTAAACCCACAAAATTATTGG - Intronic
917937693 1:179884118-179884140 GATAAAACTAACACATATATGGG - Intronic
918056372 1:181025236-181025258 CCGAAAACACACAAATATACTGG - Intergenic
919025987 1:192171110-192171132 CCAAATACCTACAAATATATAGG - Intronic
920551646 1:206866459-206866481 GCAAAAAACCACAGGTATATTGG - Intronic
921513723 1:216064432-216064454 GAGAAAACCCACAAAAACATGGG + Intronic
923204038 1:231740656-231740678 TCTAAAACCCCCCAAAATATTGG - Intronic
923357206 1:233170406-233170428 GCCAAAAACCATGAATATATGGG - Intronic
923374703 1:233349537-233349559 GCTAAAACCAACCAAAATATGGG + Intronic
924686973 1:246302948-246302970 CCTAAACACCACAAATATGTGGG + Intronic
1064803561 10:19104674-19104696 CTTAAAACCCTGAAATATATGGG - Intronic
1066119779 10:32274947-32274969 TGTAAATCTCACAAATATATTGG - Intronic
1068335554 10:55629205-55629227 TCTAAAACTCAGAAATATAATGG + Intergenic
1068899244 10:62247299-62247321 GATGAAACTCATAAATATATAGG + Intronic
1070095978 10:73338781-73338803 TGTAAAACCCACAAATATGGAGG + Intronic
1071199279 10:83200159-83200181 GGTAAAACCCACAAAATCATGGG + Intergenic
1072119891 10:92396966-92396988 GGTAAAACTCACAAAAATAAGGG - Intergenic
1072825609 10:98603301-98603323 GGTAAAACTCACAAAAATATGGG - Intronic
1072888094 10:99297876-99297898 GCTATAACCCACAATACTATAGG - Intergenic
1073618537 10:105023202-105023224 GCCAAAGCCCACACATATATGGG + Intronic
1073679161 10:105683253-105683275 GATAAAACCCACAAAAATGTAGG + Intergenic
1074551621 10:114448568-114448590 GCAAGAAGCCACAAATATGTTGG + Intronic
1077520640 11:3031843-3031865 GGTAAAACTCACAAAAGTATGGG - Intronic
1080971180 11:37279264-37279286 GATAAAACTCACAAAAGTATAGG + Intergenic
1082183561 11:49149918-49149940 ACTAAAACCCACATATATGGAGG - Intronic
1083078268 11:60064297-60064319 GATAAAACCCACAAGAACATGGG + Exonic
1083129744 11:60614080-60614102 AAAAAAACCCACAAATAAATAGG - Intergenic
1085213427 11:74804086-74804108 GAAAAAACCCACACAGATATGGG - Intronic
1086853690 11:91841093-91841115 GCTAAAACACAGAAATAGCTTGG + Intergenic
1087277258 11:96173188-96173210 GCTATCAACCACAAATATCTTGG + Intronic
1087542791 11:99542496-99542518 GGCAAAACCCACAATTATTTTGG - Intronic
1088281080 11:108135290-108135312 GCTAAAAGACACAAAAATCTAGG + Intronic
1088348654 11:108859857-108859879 GCTAATACATACAAAAATATAGG - Intronic
1089898872 11:121960634-121960656 GCTATAAGCCACTAAGATATAGG - Intergenic
1090864328 11:130684087-130684109 GCTAAAACCCTCAAAAAACTAGG - Intronic
1091106589 11:132925527-132925549 GGTAAAACCCACGAAAGTATGGG + Intronic
1092788787 12:12053928-12053950 GCTAAAACCTAGAATTGTATAGG - Intronic
1095813066 12:46391803-46391825 GCCAAAACCCACAAATCTCCTGG - Intergenic
1096955677 12:55523314-55523336 GATAGAAACCACAATTATATGGG - Intergenic
1098269037 12:68752469-68752491 GCTAGAGCCCACAAATAATTTGG + Intronic
1099380742 12:81949264-81949286 GAGAAAACCCACACAGATATGGG + Intergenic
1100358422 12:93854096-93854118 GCTTAAAACAACAAATGTATTGG + Intronic
1101457584 12:104852465-104852487 TCTAAAACCCACAAATTTGTTGG + Intronic
1104561557 12:129850049-129850071 TTTCAAATCCACAAATATATGGG - Intronic
1105617680 13:22034512-22034534 GAAACAACCCACATATATATAGG - Intergenic
1107702761 13:43064601-43064623 CCTAAAACCCAAAAATATAGTGG + Intronic
1109325487 13:60862360-60862382 GCAAAAGCCCACATATATTTAGG + Intergenic
1109954770 13:69551320-69551342 TCTAAAAACCACATATATTTTGG + Intergenic
1111040745 13:82744043-82744065 GATAAAACCAACAAAAATATTGG + Intergenic
1114921633 14:27339501-27339523 GCTAACACCCACATATATCTTGG - Intergenic
1116308278 14:43287348-43287370 GCTAAAAATCATAAATATATTGG - Intergenic
1116607802 14:47025043-47025065 GTTAAAAAACAAAAATATATTGG + Intronic
1116810995 14:49540219-49540241 GGTAAAACTCACAAAAATGTGGG - Intergenic
1116838780 14:49797908-49797930 GTGAAAACCCACAAAGACATGGG - Intronic
1118672405 14:68143636-68143658 GCCAAAAGGCACAAATATAAAGG - Intronic
1119707737 14:76796124-76796146 GCTATAACCAACAAATATAATGG + Intronic
1120363163 14:83531894-83531916 TCTAATACCTTCAAATATATGGG - Intergenic
1121902941 14:97710806-97710828 GCTCTAAGCCACACATATATAGG + Intergenic
1123928966 15:25148612-25148634 GGTAGAACCCACAAAAATGTGGG - Intergenic
1130686661 15:86043574-86043596 ACTAAAAACCATAAATCTATGGG + Intergenic
1133149757 16:3818851-3818873 GCTAAAACCTACCACTTTATAGG + Intronic
1138732631 16:59211828-59211850 GGTAAAACACACAAAAAGATTGG + Intergenic
1140293289 16:73684555-73684577 CTCAAAACCCACAAATATGTTGG + Intergenic
1145043132 17:19591743-19591765 CCTAAAACCCCCAAACAAATAGG - Intergenic
1147972497 17:44226881-44226903 GGTAAAACTCACAAAAATATAGG + Intergenic
1148307400 17:46601671-46601693 ACTTAGACCCACACATATATGGG - Intronic
1150591229 17:66564598-66564620 ACTAAAACCCACAAAGTCATGGG - Intronic
1150871288 17:68914111-68914133 GATAAAACCCTCAAAAATCTAGG + Intronic
1150889182 17:69126143-69126165 TATAAAACCCAGAAAAATATTGG + Intronic
1153558111 18:6339036-6339058 GAACAAACCCACAAATATATTGG + Intronic
1155055181 18:22176509-22176531 GCTGCAACCCACAAATATCCGGG - Intronic
1155691655 18:28632182-28632204 TCTAAAACCCACCATTCTATGGG - Intergenic
1156791896 18:40985535-40985557 GACAAAGCCCAAAAATATATGGG + Intergenic
1158680776 18:59564947-59564969 GCTAAAACCCATAAACATGATGG + Intronic
1159465875 18:68783678-68783700 TCTAAACACCAAAAATATATGGG - Intronic
1159848477 18:73495650-73495672 GGTAAAACCCACAAAAGTGTGGG - Intergenic
1164250678 19:23471978-23472000 GAAAAAACCCTCAAATATATGGG - Intergenic
1164291762 19:23876036-23876058 GAAAAAACCCTCAAATATATGGG + Intergenic
1164301990 19:23971132-23971154 GAAAAAACCCTCAAATATATGGG + Intergenic
1164323898 19:24175694-24175716 GAGAAAACCCTCAAATATTTGGG + Intergenic
1166635004 19:44443284-44443306 GAGAGACCCCACAAATATATGGG + Intronic
925952129 2:8924809-8924831 GCTAAAATACACAAATAAATTGG + Intronic
930516517 2:52414212-52414234 GGTAAAACCCACAAAAGTATGGG + Intergenic
930857128 2:56030888-56030910 GCTAAAACCCACATATTTAGAGG + Intergenic
931238891 2:60435157-60435179 GATAAAACACATAAATAAATTGG + Intergenic
933444557 2:82362958-82362980 GATAAAACTCACAAACATATGGG + Intergenic
935110454 2:100089357-100089379 AGTAAAGCCCACATATATATTGG - Intronic
935433143 2:102999556-102999578 GATAAAACCCACAAAAGTGTGGG + Intergenic
935506117 2:103905709-103905731 AAATAAACCCACAAATATATAGG - Intergenic
936124521 2:109775844-109775866 AGTAAAGCCCACATATATATTGG + Intergenic
936220168 2:110595612-110595634 AGTAAAGCCCACATATATATTGG - Intergenic
937819270 2:126289669-126289691 GGTAAAACTCACAAAAATATAGG - Intergenic
939661087 2:144890888-144890910 ACTATAACTCACAAATATTTTGG + Intergenic
940006911 2:149016535-149016557 GCTAGAGCCCACAAAAATCTAGG - Intronic
940358628 2:152772671-152772693 GCTAACACCTACAAAAATTTCGG - Intergenic
940416229 2:153424096-153424118 GGTAGAACCCACATATACATGGG - Intergenic
940929659 2:159412623-159412645 GCTAAAAATCACATATATTTTGG + Intronic
941062024 2:160857616-160857638 GGTAAAATCCACAAATTCATAGG + Intergenic
941135007 2:161704654-161704676 GTTGTACCCCACAAATATATTGG + Intronic
941781722 2:169452670-169452692 GCTTAAACCCACAAAAATCAAGG + Intergenic
943400740 2:187407317-187407339 AGTAAAACCCACATATATTTAGG + Intronic
943905535 2:193495867-193495889 GCTAAAACCAGGAAATATTTAGG + Intergenic
944655529 2:201873417-201873439 GCTAAAATCCACATATCTCTAGG - Intronic
947015912 2:225619524-225619546 GGTAAAACCCACTAATGTATGGG + Intronic
1169804783 20:9548193-9548215 GCTAAAACCCAGAAAGTTCTGGG + Intronic
1174512857 20:51068044-51068066 GCTAAAAGCCACAAAAATTCAGG + Intergenic
1174948858 20:55021087-55021109 TCTAAAAACTACAAATATTTAGG - Intergenic
1176361262 21:5998588-5998610 GACAAAATCCACAAAAATATGGG + Intergenic
1176660639 21:9632161-9632183 GCAAAAACACACAAATAAAATGG - Intergenic
1178434791 21:32548652-32548674 GATAATATCCAAAAATATATAGG - Intergenic
1179762256 21:43539962-43539984 GACAAAATCCACAAAAATATGGG - Intronic
1180732245 22:17990859-17990881 GCTAAAAACCTCACTTATATTGG - Intronic
1181516935 22:23419858-23419880 GCTAAAAACCTCACTTATATTGG - Intergenic
1184053028 22:42022856-42022878 GCCAACACACACAAAAATATGGG + Intronic
1184845344 22:47080563-47080585 GCTATAACCCACAAATTCAAAGG - Intronic
949106624 3:207111-207133 CTTAAAACTCCCAAATATATTGG - Intronic
949156895 3:838649-838671 GCTAAAAGCTACAGCTATATAGG + Intergenic
949744683 3:7275821-7275843 GGTAAAACCCACAAAGGTAGGGG + Intronic
950055724 3:10022838-10022860 TCAAAATCCCACACATATATAGG - Intergenic
950961377 3:17111517-17111539 GATAAGACAGACAAATATATTGG + Intergenic
951400775 3:22229516-22229538 GCTATAACCCACAATCATAAAGG - Intronic
953295848 3:41715600-41715622 GTTAAAAACCACAAATACTTAGG + Intronic
955170437 3:56558659-56558681 GATAAAACCCACAACTACAGGGG - Intronic
956262789 3:67363425-67363447 GCAGAAACCCACAAATACAGGGG - Intronic
957357802 3:79114619-79114641 GATAAATCCCACAAAAATTTAGG + Intronic
958526415 3:95266282-95266304 GCTAATACCCACCAATGTTTGGG - Intergenic
962884871 3:139615011-139615033 TTTAAAACCAATAAATATATTGG - Intronic
963232740 3:142925301-142925323 GGTAAAACCCACAAAAGTGTGGG + Intergenic
963747741 3:149142295-149142317 GCTAGAACCCACACATACCTTGG - Intronic
964457988 3:156889692-156889714 GCTAAAAACCACAAATGTTATGG - Intronic
964608167 3:158581242-158581264 GGTAAAACTCACAAAATTATGGG - Intronic
964918199 3:161861499-161861521 GCTGAAACCTAAAAACATATCGG + Intergenic
965268999 3:166588465-166588487 AATAAAGCCCACAAATATGTGGG - Intergenic
965789949 3:172376643-172376665 GCTGAAACCCACAAATACCATGG - Intronic
968398951 4:271172-271194 GATAAAACCCCCAAATGTAAAGG - Exonic
970926872 4:21462202-21462224 GTGAAAACACACAAATACATGGG - Intronic
973595846 4:52489144-52489166 CATAAAAGCCACAAATAAATTGG + Intergenic
974761922 4:66287366-66287388 GCTAAAATGCACAAATACTTTGG - Intergenic
975882903 4:78931856-78931878 GTTAAAACCCATTAATGTATAGG - Intronic
977187185 4:93954454-93954476 GTTAAAACACCAAAATATATAGG + Intergenic
978764821 4:112393233-112393255 GAGAAGACCCAGAAATATATTGG + Intronic
979437106 4:120706264-120706286 ACTAAAACTCAGGAATATATAGG - Intronic
980113930 4:128661200-128661222 CCTAAGACACACAAATATTTGGG - Intergenic
981032299 4:140137374-140137396 GTTAAAACCCACAACCATATGGG - Intronic
983768212 4:171514280-171514302 TCTAAAACCAACAAATACTTAGG - Intergenic
984980191 4:185273103-185273125 GCTTAAACCCATGAATAGATTGG + Intronic
985414719 4:189724253-189724275 GCAAAAACACACAAATAAAATGG + Intergenic
987273092 5:16333293-16333315 GTGAAAACCCACAAATATAGAGG + Intergenic
987921768 5:24292681-24292703 GGTAAATCGAACAAATATATAGG - Intergenic
989959841 5:50399488-50399510 GTTTATACCCCCAAATATATGGG + Intronic
990499263 5:56379183-56379205 GGTAAAACTCACAAAAATACAGG - Intergenic
990735554 5:58857662-58857684 GCTACAACCTAAAAATACATTGG - Exonic
990926011 5:61023643-61023665 TTTAAAACCCTCACATATATAGG + Intronic
992919249 5:81496069-81496091 TCTAAAACGCACAATTATACAGG + Intronic
993059468 5:83021619-83021641 GGTAAAAGCCACAAAAATAAAGG - Intergenic
993207745 5:84906037-84906059 GGTAAAACCCACAAAAGTGTGGG - Intergenic
993347422 5:86801773-86801795 GCCTAAACCCATAAATATGTAGG + Intergenic
993487028 5:88499459-88499481 GCTAACAACAACAAAAATATTGG + Intergenic
994523403 5:100872235-100872257 GCTGTACCCCATAAATATATAGG - Intronic
994747569 5:103697698-103697720 GGTAAAACACACAAATATGTGGG - Intergenic
995749372 5:115438252-115438274 GCTAAAACCAGCCAATATAGGGG + Intergenic
1000913991 5:167057863-167057885 GTTAAAACTCACAAATATGTTGG + Intergenic
1002205003 5:177556392-177556414 AATAAATCTCACAAATATATAGG + Intergenic
1005595946 6:27379620-27379642 GGTAAAACTCACAAAAGTATGGG - Intronic
1008690194 6:53970125-53970147 GCTAGAACCCAAAATTATAAGGG - Intronic
1009201108 6:60747222-60747244 GCTCAAACCCAAGAATAAATAGG - Intergenic
1009652699 6:66496588-66496610 GCTGAAATCCTCAAATATATTGG - Intergenic
1009733229 6:67637029-67637051 GATAAAACCAACAAATATCTCGG - Intergenic
1011273834 6:85607999-85608021 GCTAAAACCCACAAATATATTGG + Intronic
1012592754 6:101002900-101002922 GCTAACAACAACAAATATCTAGG + Intergenic
1014502759 6:122213213-122213235 GACAAAACTCAGAAATATATAGG + Intergenic
1014816926 6:125946203-125946225 GCTAAGAGCAACAAATACATGGG + Intergenic
1015269032 6:131320489-131320511 CCTTAAAGCCAGAAATATATTGG + Intergenic
1015955720 6:138596023-138596045 GCTAAAACCAAAAAATATCCAGG + Intronic
1020457681 7:8392792-8392814 GATAAATCCCATAAAAATATAGG - Intergenic
1024848214 7:53676369-53676391 GTTAAAACCCTCAAATAATTAGG - Intergenic
1025224600 7:57146028-57146050 TTTAAAACTCACAAATATGTGGG - Intergenic
1031546928 7:123062514-123062536 TCTAAAACTCATAAATAGATGGG + Intergenic
1035095723 7:156353355-156353377 GTTAATAGCCACAAAAATATAGG - Intergenic
1037119138 8:15262243-15262265 GGTAAAACTCACAGAAATATGGG - Intergenic
1040475134 8:47769606-47769628 ACTAAAACCAACAATTATAAAGG + Intergenic
1041814996 8:61960730-61960752 GCTACAACCCACAATTAGAGAGG - Intergenic
1044243658 8:89915893-89915915 GCTAAAAGCAACAAATAATTTGG - Intronic
1045292058 8:100842184-100842206 GACAAAACCCACAATTATTTTGG + Intergenic
1048128024 8:131659114-131659136 GCTGAGACCAACAAATATAGGGG + Intergenic
1051211739 9:14752260-14752282 TCTAAAGCCCACATTTATATAGG - Intronic
1052773089 9:32707118-32707140 GGTGACACTCACAAATATATAGG - Intergenic
1058361152 9:104147848-104147870 ACAAAAAGCCACAAATATAATGG + Intergenic
1058491138 9:105500679-105500701 GGTAAAACTCACAAATGTGTGGG + Intronic
1203638208 Un_KI270750v1:134005-134027 GCAAAAACACACAAATAAAATGG - Intergenic
1186532915 X:10315426-10315448 ACAAAGAACCACAAATATATAGG + Intergenic
1188782522 X:34303149-34303171 GCCAAAACCCACACAGACATGGG - Intergenic
1189698176 X:43687402-43687424 GTTAAAGCCCAGAAATTTATTGG + Intronic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1191586912 X:62837563-62837585 GCTAAGAACAACAAAAATATTGG - Intergenic
1192361334 X:70442348-70442370 GAGAAAACCCACACATACATGGG - Intergenic
1195135454 X:101902548-101902570 GCTAATTTCCACATATATATTGG - Intronic
1195454684 X:105054249-105054271 GAGAAAACCCACATAGATATGGG + Intronic
1197428960 X:126335229-126335251 ATTAAAACTCACAAATTTATGGG + Intergenic
1197791837 X:130262856-130262878 GCTGAAACCAAAAAATAAATAGG - Intronic
1197830660 X:130639045-130639067 GCTAAAACTTACAAATGTGTGGG - Intronic
1199366838 X:146996189-146996211 GCAAAAACAAACAAACATATTGG - Intergenic
1199456386 X:148034015-148034037 GCGAAAACCCACGCAGATATGGG - Intergenic