ID: 1011277200

View in Genome Browser
Species Human (GRCh38)
Location 6:85642968-85642990
Sequence GCGGGGGCGCGCGCGCGCAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 418}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011277200 Original CRISPR GCGGGGGCGCGCGCGCGCAC CGG (reversed) Exonic