ID: 1011278933

View in Genome Browser
Species Human (GRCh38)
Location 6:85657493-85657515
Sequence GTATGGTGTCCTCTGGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011278933_1011278935 -8 Left 1011278933 6:85657493-85657515 CCTTACTCCAGAGGACACCATAC No data
Right 1011278935 6:85657508-85657530 CACCATACTATTGTAGTGAGAGG No data
1011278933_1011278936 -7 Left 1011278933 6:85657493-85657515 CCTTACTCCAGAGGACACCATAC No data
Right 1011278936 6:85657509-85657531 ACCATACTATTGTAGTGAGAGGG No data
1011278933_1011278939 25 Left 1011278933 6:85657493-85657515 CCTTACTCCAGAGGACACCATAC No data
Right 1011278939 6:85657541-85657563 CAGTGGATACAAATGAAAGCTGG No data
1011278933_1011278938 8 Left 1011278933 6:85657493-85657515 CCTTACTCCAGAGGACACCATAC No data
Right 1011278938 6:85657524-85657546 TGAGAGGGAATGAAAAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011278933 Original CRISPR GTATGGTGTCCTCTGGAGTA AGG (reversed) Intergenic
No off target data available for this crispr