ID: 1011278934

View in Genome Browser
Species Human (GRCh38)
Location 6:85657500-85657522
Sequence TACAATAGTATGGTGTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011278934_1011278940 25 Left 1011278934 6:85657500-85657522 CCAGAGGACACCATACTATTGTA No data
Right 1011278940 6:85657548-85657570 TACAAATGAAAGCTGGTGTAAGG No data
1011278934_1011278938 1 Left 1011278934 6:85657500-85657522 CCAGAGGACACCATACTATTGTA No data
Right 1011278938 6:85657524-85657546 TGAGAGGGAATGAAAAACAGTGG No data
1011278934_1011278939 18 Left 1011278934 6:85657500-85657522 CCAGAGGACACCATACTATTGTA No data
Right 1011278939 6:85657541-85657563 CAGTGGATACAAATGAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011278934 Original CRISPR TACAATAGTATGGTGTCCTC TGG (reversed) Intergenic
No off target data available for this crispr