ID: 1011278939

View in Genome Browser
Species Human (GRCh38)
Location 6:85657541-85657563
Sequence CAGTGGATACAAATGAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011278933_1011278939 25 Left 1011278933 6:85657493-85657515 CCTTACTCCAGAGGACACCATAC No data
Right 1011278939 6:85657541-85657563 CAGTGGATACAAATGAAAGCTGG No data
1011278934_1011278939 18 Left 1011278934 6:85657500-85657522 CCAGAGGACACCATACTATTGTA No data
Right 1011278939 6:85657541-85657563 CAGTGGATACAAATGAAAGCTGG No data
1011278937_1011278939 8 Left 1011278937 6:85657510-85657532 CCATACTATTGTAGTGAGAGGGA No data
Right 1011278939 6:85657541-85657563 CAGTGGATACAAATGAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011278939 Original CRISPR CAGTGGATACAAATGAAAGC TGG Intergenic
No off target data available for this crispr