ID: 1011281941

View in Genome Browser
Species Human (GRCh38)
Location 6:85686501-85686523
Sequence GGGAAAAAACAGAGAGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011281936_1011281941 5 Left 1011281936 6:85686473-85686495 CCAAAAGAGGAAACCAATGGATG No data
Right 1011281941 6:85686501-85686523 GGGAAAAAACAGAGAGAACAGGG No data
1011281939_1011281941 -8 Left 1011281939 6:85686486-85686508 CCAATGGATGTCAAAGGGAAAAA No data
Right 1011281941 6:85686501-85686523 GGGAAAAAACAGAGAGAACAGGG No data
1011281934_1011281941 13 Left 1011281934 6:85686465-85686487 CCAGAGGACCAAAAGAGGAAACC No data
Right 1011281941 6:85686501-85686523 GGGAAAAAACAGAGAGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011281941 Original CRISPR GGGAAAAAACAGAGAGAACA GGG Intergenic
No off target data available for this crispr