ID: 1011294304

View in Genome Browser
Species Human (GRCh38)
Location 6:85809832-85809854
Sequence AAGGCTAAAGGCCCTTTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011294297_1011294304 27 Left 1011294297 6:85809782-85809804 CCTAAGGGAAGAATCATGGGAAA No data
Right 1011294304 6:85809832-85809854 AAGGCTAAAGGCCCTTTTTTTGG No data
1011294296_1011294304 28 Left 1011294296 6:85809781-85809803 CCCTAAGGGAAGAATCATGGGAA No data
Right 1011294304 6:85809832-85809854 AAGGCTAAAGGCCCTTTTTTTGG No data
1011294300_1011294304 -4 Left 1011294300 6:85809813-85809835 CCTATGAAGTCCTAGGATTAAGG No data
Right 1011294304 6:85809832-85809854 AAGGCTAAAGGCCCTTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011294304 Original CRISPR AAGGCTAAAGGCCCTTTTTT TGG Intergenic
No off target data available for this crispr