ID: 1011299977

View in Genome Browser
Species Human (GRCh38)
Location 6:85863760-85863782
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 3, 1: 12, 2: 14, 3: 31, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011299974_1011299977 8 Left 1011299974 6:85863729-85863751 CCTTAAGTTTCAGCTGTGTATAG No data
Right 1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG 0: 3
1: 12
2: 14
3: 31
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011299977 Original CRISPR GCCTCCGGAGTGACCAGAGC AGG Intergenic
900326329 1:2110321-2110343 GCCCCGGGCGTGATCAGAGCAGG + Intronic
900413856 1:2526214-2526236 GGCGCCGCAGGGACCAGAGCGGG - Intronic
901987766 1:13089755-13089777 GCTTCTGGAGTGACCAGAGCAGG - Intergenic
901994046 1:13137012-13137034 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
902990812 1:20186033-20186055 GCTTCCGGCGTGACCGGAACCGG - Intergenic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
906201473 1:43963298-43963320 GCCTCAGGAATGATCAGAACTGG + Intronic
907123987 1:52033187-52033209 GAATCCGGAGTCACAAGAGCTGG + Exonic
907326344 1:53640956-53640978 GCCTCTGGAGGGAACAGAACCGG + Intronic
921045186 1:211471483-211471505 TCCTCTGGAGTGTCCAGACCTGG - Intergenic
921433691 1:215091733-215091755 GCCTCCTTAGTGACCATATCTGG - Intronic
922500951 1:226096541-226096563 GCCTCCAGGGGGACCACAGCTGG - Intergenic
1065214446 10:23437307-23437329 GCGGCTGGAGTGACCTGAGCTGG + Intergenic
1067133240 10:43585268-43585290 GCTTCCGGAGTGACCACAGCAGG + Intergenic
1069655257 10:70083138-70083160 GCCCCCGGGGTCTCCAGAGCTGG + Intronic
1070599104 10:77853501-77853523 GGCTCCTGAGTGACCAGACTCGG - Exonic
1072105670 10:92271060-92271082 GCCTCCTGAGTGACTGGGGCTGG - Intronic
1072656075 10:97331514-97331536 GCCTCGGGAGTGTGCTGAGCAGG + Intergenic
1073069753 10:100785839-100785861 GCCTCTGGAGTGAGCACAGCAGG + Intronic
1074308335 10:112299511-112299533 GCCTCCTGCGAGACCAGACCGGG + Exonic
1076856259 10:133116793-133116815 GACTCGGAACTGACCAGAGCTGG - Intronic
1077443350 11:2578827-2578849 GCCTTCGGGGTGGCCACAGCGGG + Intronic
1079182906 11:18209330-18209352 AGCTCCGGAGGGAGCAGAGCTGG + Exonic
1081737090 11:45411634-45411656 GCCCCAGGAGTGAGCAAAGCAGG - Intergenic
1082789138 11:57335450-57335472 CCCGCCGGAGCGGCCAGAGCGGG - Intronic
1082910325 11:58365965-58365987 GTCCATGGAGTGACCAGAGCTGG + Intergenic
1082960992 11:58918766-58918788 GCTTCCAGAGTGACTAGAGCAGG + Intronic
1084390363 11:68871674-68871696 GCCTCCAGAGTGACTAGAGCAGG - Intergenic
1084430241 11:69106856-69106878 ACCTGCTGAGTGACCAGGGCAGG + Intergenic
1085010506 11:73137784-73137806 ACGTCCCGAGTGACCAGAGCAGG + Intronic
1085572868 11:77574348-77574370 GCCTCCGGAGTGACCAGAACAGG - Intronic
1085803807 11:79616103-79616125 GGCTCTGGAGTGAGAAGAGCTGG - Intergenic
1088646336 11:111919510-111919532 GTCTGCGGAATGGCCAGAGCAGG + Intronic
1089577992 11:119460272-119460294 CCTTCGGGAGTGACCAGACCTGG - Intergenic
1090030768 11:123204213-123204235 GCCTCTGAAGTGAGCAGAGATGG + Intergenic
1090619258 11:128547122-128547144 CCCTTGGGACTGACCAGAGCAGG + Intronic
1090670641 11:128942880-128942902 GCTTTCGGAGTGAGCTGAGCAGG + Exonic
1091324069 11:134671063-134671085 GCCTTTGCAGTGACCTGAGCGGG + Intergenic
1092245721 12:6863278-6863300 TCATCCGGAGTGACCAGGGGTGG - Exonic
1092654896 12:10673972-10673994 GAAACCGGAGTGACCAGAGGAGG - Exonic
1095421354 12:42027732-42027754 GGCTCTGCAGTGACCGGAGCAGG - Intergenic
1096138895 12:49225945-49225967 GCCACGGGCGTGGCCAGAGCTGG + Intronic
1096339859 12:50788601-50788623 GCCTCCTGAGTAGCTAGAGCTGG + Intronic
1102199279 12:111046272-111046294 GCTTGCGGAGAGACCAGTGCAGG + Intronic
1106914720 13:34500135-34500157 ACAGCAGGAGTGACCAGAGCTGG - Intergenic
1112367496 13:98767831-98767853 GCTTCCAGAGTGACCAGAGCAGG - Intergenic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1118056490 14:62084406-62084428 GCCTCTGGAAGAACCAGAGCTGG - Intronic
1118313022 14:64706766-64706788 GCCTGCGGGATGACCAGGGCTGG + Intronic
1118951388 14:70439439-70439461 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
1121429038 14:93873970-93873992 GCCTCAGGAGGGGGCAGAGCTGG - Intergenic
1122691747 14:103534942-103534964 GCCTCCTGGGTGGCCAGAGTGGG + Exonic
1122922862 14:104887127-104887149 GCCTGCGTAGTGGCAAGAGCGGG + Exonic
1122983769 14:105203047-105203069 GCCTCCGGATTCACCAGATGGGG + Intergenic
1123218934 14:106839144-106839166 GCTTCCGAAGTAAGCAGAGCCGG + Intergenic
1123701592 15:22918241-22918263 GCCTCCGCACGGAGCAGAGCTGG + Intronic
1124121214 15:26890784-26890806 TCCTCCTGAGTGCCCAGTGCCGG - Intronic
1128600645 15:68992812-68992834 GCTTCTGGGGTGACTAGAGCAGG + Intronic
1128600652 15:68992877-68992899 GCTTTCGGAGTGACCAGAGCAGG + Intronic
1128976239 15:72155876-72155898 GCCTTCCGAGTGGCCAGAGCTGG + Intergenic
1129714189 15:77837410-77837432 GAGTCCAGTGTGACCAGAGCTGG - Intergenic
1129851567 15:78796772-78796794 GCCTCCAGTGTACCCAGAGCTGG - Exonic
1133222428 16:4324437-4324459 TCCTGGGGAGTGACCACAGCTGG - Intronic
1133279066 16:4655031-4655053 GCATTTGGAGTGACCAGGGCAGG + Intronic
1133678270 16:8096368-8096390 GCTTCAGCTGTGACCAGAGCTGG - Intergenic
1134290886 16:12902212-12902234 GCCTCCGGAGAGGCCAGCGAGGG + Exonic
1134625523 16:15720072-15720094 GCCACCGAAGTCAGCAGAGCGGG - Intronic
1134809532 16:17155536-17155558 CCCTCCCAAGTGACCAGAGCTGG - Intronic
1135228128 16:20679313-20679335 GCCTCCAGTGTGGTCAGAGCAGG - Intronic
1136271951 16:29153699-29153721 GCCTCCGGAGGGACTATGGCTGG - Intergenic
1136716910 16:32288819-32288841 GCCTGCAGAGGGAACAGAGCTGG + Intergenic
1137614788 16:49839672-49839694 GCCTCCAGAGAGAACAGAGCCGG + Intronic
1138351665 16:56349218-56349240 GCCACTAGAGTGACCTGAGCTGG - Intronic
1141141205 16:81497903-81497925 GCCTCTGGGGGGACCACAGCTGG - Intronic
1141731854 16:85828316-85828338 GCCTCGGGAGTGACCTGCACAGG + Intergenic
1203145458 16_KI270728v1_random:1795385-1795407 GCCTGCAGAGGGAACAGAGCTGG + Intergenic
1145269411 17:21396730-21396752 ACCCCTGGAGTCACCAGAGCCGG + Intronic
1145902125 17:28496086-28496108 ACCTCAGGAATGACCAGAACAGG - Intronic
1146923663 17:36729903-36729925 GCCTGCGGTGTGCCCTGAGCTGG - Intergenic
1147331272 17:39700698-39700720 GCCTCCGGACTGGCCTGGGCTGG + Intronic
1148446253 17:47739368-47739390 GCCTCCCGAGTCACCCGAGCGGG - Intronic
1150217003 17:63476679-63476701 GCCTCCGGAGTGACAAGGCCGGG - Intergenic
1150431690 17:65123280-65123302 GCCTCCCGTGAGCCCAGAGCAGG + Intergenic
1151882956 17:76905864-76905886 GGCACCAGAGTGACCAGATCGGG - Intronic
1152061080 17:78075705-78075727 GCCACATGAGTGACCACAGCTGG + Intronic
1152789227 17:82269770-82269792 GCCTGCGGGGTGAACACAGCAGG + Intronic
1152842271 17:82577697-82577719 GCCTCCAAAGGGACTAGAGCTGG + Intronic
1154108581 18:11546929-11546951 GCTTCCAGTGTGACTAGAGCAGG + Intergenic
1154108590 18:11546994-11547016 GCCTCCTGATTGGCCAGAGCAGG + Intergenic
1154294798 18:13138547-13138569 GCCTCCCGAGGTACAAGAGCAGG - Intergenic
1156622939 18:38874239-38874261 GCCCCCTGAGTGGACAGAGCTGG - Intergenic
1160714061 19:567493-567515 GCTTCCGGGGTGACTAGAGCAGG + Intergenic
1160941190 19:1621170-1621192 GGCTCCCGAGGGACCACAGCTGG - Exonic
1161260604 19:3335781-3335803 GCCACCGGTGTGACCAGACCAGG + Intergenic
1162584299 19:11549723-11549745 GACTCCCGAGTACCCAGAGCTGG + Exonic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1164017081 19:21262678-21262700 GCCTCCAGAGTGGTCAGAGCAGG - Intronic
1164033596 19:21433819-21433841 GCTTCCAGAATGACCAGAGCAGG + Intronic
1164054456 19:21610008-21610030 GCCTCCAGTGTGGTCAGAGCAGG - Intergenic
1164142567 19:22486246-22486268 GCTTCCAGTGTGACTAGAGCGGG + Intronic
1164142573 19:22486311-22486333 GCTTCCGAAGTGACCAGAGCAGG + Intronic
1164148598 19:22529186-22529208 GCCTCCGGAGTGACCAGGGCAGG - Intronic
1164286107 19:23819283-23819305 GCTTCTGAAGTGACCAGAGCAGG + Intronic
1165129526 19:33623023-33623045 GCCTCCAGCGAGGCCAGAGCGGG - Intronic
1165358592 19:35319400-35319422 GGCTCTGGAGTGGCCAGTGCTGG - Intronic
1166083541 19:40459982-40460004 GCCTACAGACTGACCAGTGCTGG + Intronic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168004236 19:53473397-53473419 GCCTCCAGAGTGACCAGAGCAGG + Intronic
927825229 2:26303986-26304008 TCCTCCGGTGTGGTCAGAGCAGG - Intergenic
934474918 2:94587445-94587467 GCCTCCTCAGTGCCCAGATCTGG + Intergenic
934576776 2:95406922-95406944 GGCTCTGTAGAGACCAGAGCAGG - Exonic
934638995 2:96015090-96015112 GGCTCTGTAGAGACCAGAGCAGG - Intergenic
934662479 2:96150479-96150501 GGCTCCCCTGTGACCAGAGCTGG + Intergenic
934794653 2:97090322-97090344 GGCTCTGTAGAGACCAGAGCAGG + Exonic
935757899 2:106291182-106291204 GCTTCCTCAGTGAACAGAGCAGG + Intergenic
942446534 2:176082136-176082158 GCCCCCGGGGAGGCCAGAGCAGG + Intronic
943356850 2:186867088-186867110 GTCCTCTGAGTGACCAGAGCTGG + Intergenic
946713860 2:222533215-222533237 GCCTCAGGAGGGACCAGAAGAGG + Intronic
946808906 2:223501367-223501389 GACACCTCAGTGACCAGAGCTGG - Intergenic
1170850831 20:20003148-20003170 GCCTTCGGTGGGACGAGAGCGGG + Intergenic
1171003201 20:21435747-21435769 GTCTCCGGAGAGAGCAGAGCAGG + Intergenic
1172113631 20:32561497-32561519 GCCTCTGGGGGGCCCAGAGCAGG + Intronic
1172123482 20:32611883-32611905 GCCTCCTCTGTGAACAGAGCTGG - Intergenic
1173954267 20:47018575-47018597 GCCACAGGAGGGGCCAGAGCTGG + Intronic
1174275546 20:49401134-49401156 GCCTTCGGAGTAGCCACAGCAGG - Intronic
1174861770 20:54098017-54098039 GCCACCTGAGTGCCAAGAGCAGG + Intergenic
1175824752 20:61930859-61930881 GCCCCCGGTGTTTCCAGAGCAGG - Intronic
1175986174 20:62765140-62765162 ACCTCCAGAGTGACAGGAGCGGG - Intergenic
1176024018 20:62976754-62976776 GCCTCCGGAGGAACCAGTCCTGG - Intergenic
1176170598 20:63694767-63694789 GGGTCTGGAGTGCCCAGAGCAGG + Exonic
1176346348 21:5751893-5751915 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1176353162 21:5872477-5872499 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1176498479 21:7572562-7572584 GCCTCCAGTGTGGTCAGAGCAGG - Intergenic
1176540669 21:8149963-8149985 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1176559620 21:8333008-8333030 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1179086814 21:38225659-38225681 GCTTCCAGGGTGACTAGAGCAGG + Intronic
1179086823 21:38225723-38225745 GCTTCTGGAGTGACCAGAGCAGG + Intronic
1179931866 21:44575977-44575999 GCCAGCGGACTGCCCAGAGCAGG + Intronic
1182829769 22:33295574-33295596 GCCTCCAGAGTGAGCAGCACAGG - Intronic
1183623426 22:38987676-38987698 GCCTCCGCTGTGAGCAGAGGAGG + Intronic
1183630236 22:39028133-39028155 GCCTCCGCTGTGAGCAGAGTAGG + Intronic
1184943321 22:47784142-47784164 GCGTGGGGAGTGACCAGGGCCGG - Intergenic
1185148143 22:49150268-49150290 GACCCAGGAGTGAACAGAGCAGG - Intergenic
1203245610 22_KI270733v1_random:66381-66403 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
949862244 3:8516277-8516299 CCCTCCTGAGAGACAAGAGCCGG + Intronic
953051725 3:39350243-39350265 GCTTCCGGTGTGGTCAGAGCAGG - Intergenic
953290241 3:41653205-41653227 GGCTCTGGAGTGATCAGGGCAGG - Intronic
954139298 3:48596614-48596636 GACTCTGGTGTGGCCAGAGCTGG + Intergenic
956449899 3:69363731-69363753 GGCTCCCCATTGACCAGAGCTGG + Intronic
959961921 3:112307054-112307076 GCCTCCGGAGTGGCCACAGCAGG - Intergenic
960742150 3:120846216-120846238 AGCTCTGGAGTGAGCAGAGCTGG + Intergenic
961033991 3:123629623-123629645 GACTCTGGAGAGACAAGAGCAGG + Exonic
961715654 3:128855752-128855774 GCTTCTGGAGTCACCAGAGCAGG + Intergenic
961899992 3:130201093-130201115 GACTGCGGAGGGACCATAGCAGG - Intergenic
965923272 3:173945371-173945393 GCCTCTGGAGTGTGCAGAGCTGG + Intronic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
971264931 4:25088865-25088887 GCCTCCTGAGCGAGCAGCGCCGG - Intergenic
972105695 4:35482975-35482997 GACTCTGGAGTCACCAGACCAGG + Intergenic
972480185 4:39489304-39489326 GCTTCTGGAGTGACTAGAGCAGG - Intergenic
974976549 4:68901219-68901241 GCTTCCGGAGTGACCAGAATAGG + Intergenic
978953588 4:114590829-114590851 GCTTCCAGTGTGATCAGAGCAGG + Intergenic
979058031 4:116018946-116018968 GCTTCCAGAGTTACCAGAGCAGG - Intergenic
979058036 4:116019010-116019032 GCTTCCGGGGTGACTAGAGCAGG - Intergenic
985633914 5:1026834-1026856 GCCTCCCGAGTGCCCTGAGGTGG + Intronic
991418093 5:66412102-66412124 GCCTCCAGGGTGACCATAGTGGG - Intergenic
991537446 5:67686456-67686478 GCCACAGAAGTGACCTGAGCAGG - Intergenic
998375547 5:141688229-141688251 GCTTTGGGAGTGACCAGAGGGGG + Intergenic
1001254567 5:170173509-170173531 GCCTACAGAGTGGCCAGCGCTGG + Intergenic
1001264119 5:170260056-170260078 CCCTCAGGAGTGTCCTGAGCAGG - Intronic
1002311124 5:178314432-178314454 ACCACCCCAGTGACCAGAGCTGG + Intronic
1003317673 6:5026694-5026716 GCCTATGGAGTCACCAGGGCAGG - Intergenic
1004478897 6:16000261-16000283 TACTCTGGAGTGACCAGAGAAGG - Intergenic
1004503311 6:16227755-16227777 GCCTCCGGAGTGAGCAGAGCAGG + Intergenic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1007759698 6:44126999-44127021 CGCTCCGGAGTGACCAGCGACGG + Exonic
1007809553 6:44476291-44476313 GCCTTCGGAGTGAGGAGAGGCGG - Intergenic
1008583346 6:52926068-52926090 GCCTCCAGAGTGACCAGAGCAGG - Intergenic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1016272156 6:142301854-142301876 GCTTCCGGCGTGACTGGAGCTGG - Intronic
1019748527 7:2714159-2714181 CCCTTCGGAGTGACGAGGGCGGG + Exonic
1020112667 7:5456272-5456294 GCCTCCTGAGAGCCCAGGGCAGG - Intronic
1023871708 7:44266763-44266785 GCCTCCTGAGTGGCCAGCCCTGG + Intronic
1024497644 7:50066809-50066831 GCCTCCAGTGTGGTCAGAGCAGG + Intronic
1025823535 7:64993186-64993208 GCTTCTGGGGTGACTAGAGCAGG + Exonic
1025823542 7:64993250-64993272 GCTTCCGGAGTGACCAGAGCAGG + Exonic
1026051813 7:66953058-66953080 GCCTCCTAAATGACCAAAGCTGG - Intronic
1026919483 7:74144684-74144706 GCCTCCCGAGTAATCCGAGCCGG + Intergenic
1029161366 7:98554716-98554738 GCCACGGGTGTGAGCAGAGCAGG - Intergenic
1031300241 7:120055522-120055544 GCTTCCAGGGTGACTAGAGCAGG + Intergenic
1032783168 7:135180336-135180358 GCCTCCAGAGTGATCACAGCAGG - Intergenic
1033109153 7:138559552-138559574 GCTTCTGGGGTGACTAGAGCCGG + Intronic
1033365065 7:140666710-140666732 GCTTCCGGAGTGACCAGAGCAGG - Intronic
1034163383 7:149008114-149008136 GCCTGCGGGGTGTCCAGGGCTGG + Intronic
1034489818 7:151387240-151387262 GCTTCCTGGGTGACCAGGGCAGG + Intronic
1039889170 8:41672705-41672727 TCCTCAGCAGTGACCAGAGAAGG + Exonic
1041008753 8:53521221-53521243 GCCTCCAGAGTAACCAGAGCAGG + Intergenic
1041527368 8:58822483-58822505 ACAGCAGGAGTGACCAGAGCCGG + Intronic
1043284364 8:78511381-78511403 CCCTACGGAGTGACGAGAACAGG + Intergenic
1044837748 8:96312808-96312830 GCCTCCGGGGTCAGGAGAGCAGG - Intronic
1046797499 8:118388841-118388863 GCCAACAGAGAGACCAGAGCTGG + Intronic
1047401675 8:124553503-124553525 ACCCCTGGAGTGACCATAGCAGG + Exonic
1048208070 8:132431444-132431466 ACCTCCCTAGAGACCAGAGCTGG - Intronic
1048427867 8:134339243-134339265 GCCTCAGGTTTGACCTGAGCTGG - Intergenic
1049010441 8:139883817-139883839 GGCTCCAGAGTGAGCAGAGCCGG - Intronic
1049605107 8:143525751-143525773 ACCCACGCAGTGACCAGAGCTGG + Intronic
1049606694 8:143532900-143532922 GCCGCCTGAGTGACCAGGCCAGG + Intronic
1053683155 9:40498656-40498678 GCCTCCTCAGTGCCCAGATCTGG - Intergenic
1053933133 9:43126972-43126994 GCCTCCTCAGTGCCCAGATCTGG - Intergenic
1054280559 9:63126272-63126294 GCCTCCTCAGTGCCCAGATCTGG + Intergenic
1054296256 9:63334154-63334176 GCCTCCTCAGTGCCCAGATCTGG - Intergenic
1054394272 9:64638659-64638681 GCCTCCTCAGTGCCCAGATCTGG - Intergenic
1054428922 9:65143858-65143880 GCCTCCTCAGTGCCCAGATCTGG - Intergenic
1054501458 9:65877677-65877699 GCCTCCTCAGTGCCCAGATCTGG + Intronic
1057305339 9:93909063-93909085 CCCCCCAGAGTGACCAGAGGTGG - Intergenic
1057855252 9:98596498-98596520 TCCTCAGGAGGGACCAGAGAGGG - Intronic
1060819248 9:126651980-126652002 GCCTCGGTAGTGGCCAGAGATGG + Intronic
1061068198 9:128292288-128292310 GCCACCAGAGTGACCACAGCAGG + Intergenic
1061264873 9:129499089-129499111 GGTTCCAGAGTGACCAGGGCTGG - Intergenic
1061794602 9:133078649-133078671 GCCTCACGAGTGACCAGAGCAGG + Intronic
1061852740 9:133425431-133425453 GCCCCCGGAGTGTGAAGAGCTGG - Intronic
1062595968 9:137299415-137299437 ACCTCCAGCGTGCCCAGAGCTGG - Intergenic
1062710295 9:137971756-137971778 GCCTGGGGTGTGTCCAGAGCTGG + Intronic
1203461948 Un_GL000220v1:49453-49475 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1187341380 X:18425051-18425073 CCCTCCGGAGGGACCCGTGCCGG - Intergenic
1189353773 X:40296428-40296450 CCCACCGGGGTGGCCAGAGCAGG + Intergenic
1190343240 X:49313849-49313871 GCCTCTGGTGTGGTCAGAGCAGG - Intronic
1191755514 X:64588340-64588362 GCCTTCGGAGAGACCAGTCCTGG - Intergenic
1194090806 X:89580687-89580709 GCTTCTGGGGTGACTAGAGCAGG + Intergenic
1194090813 X:89580751-89580773 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1196867399 X:120082805-120082827 GCCTCCGGTGTGGTCAGAGCAGG + Intergenic
1196875700 X:120153477-120153499 GCCTCCGGTGTGGTCAGAGCAGG - Intergenic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1200443458 Y:3236747-3236769 GCTTCTGGGGTGACTAGAGCAGG + Intergenic
1200443465 Y:3236811-3236833 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1200779559 Y:7201958-7201980 GCCTCCAGAGTGGTCAGAGCAGG - Intergenic
1201378323 Y:13345312-13345334 GCCTCCGGTATGGTCAGAGCAGG - Intronic
1201858325 Y:18569472-18569494 GCTTTTGGAGTGACCAGAGCAGG + Intronic
1201860304 Y:18590490-18590512 GCTTTTGGAGGGACCAGAGCAGG + Intergenic
1201873019 Y:18729891-18729913 GCTTTTGGAGGGACCAGAGCAGG - Intergenic
1201874996 Y:18750909-18750931 GCTTTTGGAGTGACCAGAGCAGG - Intronic
1202051952 Y:20790811-20790833 GCCTCCGGTGTGGTCAGAGCAGG + Intergenic
1202168721 Y:22018600-22018622 GCTTTCGGAATGACCAGAGTAGG - Intergenic
1202222640 Y:22567768-22567790 GCTTTCGGAATGACCAGAGTAGG + Intergenic
1202320475 Y:23627892-23627914 GCTTTCGGAATGACCAGAGTAGG - Intergenic
1202550292 Y:26042164-26042186 GCTTTCGGAATGACCAGAGTAGG + Intergenic