ID: 1011309447

View in Genome Browser
Species Human (GRCh38)
Location 6:85966049-85966071
Sequence AACTGATGAACTATAGCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011309444_1011309447 5 Left 1011309444 6:85966021-85966043 CCTCTGTTTGGCAATATCTTATG No data
Right 1011309447 6:85966049-85966071 AACTGATGAACTATAGCATAGGG No data
1011309442_1011309447 18 Left 1011309442 6:85966008-85966030 CCATTGTGACTGGCCTCTGTTTG No data
Right 1011309447 6:85966049-85966071 AACTGATGAACTATAGCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011309447 Original CRISPR AACTGATGAACTATAGCATA GGG Intergenic
No off target data available for this crispr