ID: 1011312595

View in Genome Browser
Species Human (GRCh38)
Location 6:85996741-85996763
Sequence CTGGATAATTCTTGTTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011312585_1011312595 25 Left 1011312585 6:85996693-85996715 CCACTGTATTCTAGAATCTCTGA No data
Right 1011312595 6:85996741-85996763 CTGGATAATTCTTGTTTTGGGGG No data
1011312589_1011312595 0 Left 1011312589 6:85996718-85996740 CCTGGGACTATTGAAATTTTGGG No data
Right 1011312595 6:85996741-85996763 CTGGATAATTCTTGTTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011312595 Original CRISPR CTGGATAATTCTTGTTTTGG GGG Intergenic
No off target data available for this crispr