ID: 1011315921

View in Genome Browser
Species Human (GRCh38)
Location 6:86031023-86031045
Sequence TAAAGTTTACAGAAGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011315921_1011315926 16 Left 1011315921 6:86031023-86031045 CCCTGCCTCTTCTGTAAACTTTA No data
Right 1011315926 6:86031062-86031084 GGACAGTTAATCATTAACCTAGG No data
1011315921_1011315924 -5 Left 1011315921 6:86031023-86031045 CCCTGCCTCTTCTGTAAACTTTA No data
Right 1011315924 6:86031041-86031063 CTTTAACTTGACCACAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011315921 Original CRISPR TAAAGTTTACAGAAGAGGCA GGG (reversed) Intergenic
No off target data available for this crispr