ID: 1011326346

View in Genome Browser
Species Human (GRCh38)
Location 6:86152740-86152762
Sequence CATTCTGAGGAACACATGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011326346_1011326349 6 Left 1011326346 6:86152740-86152762 CCACTCATGTGTTCCTCAGAATG No data
Right 1011326349 6:86152769-86152791 TGCTTGTGTGTCTGCCTGCTAGG 0: 8
1: 56
2: 80
3: 159
4: 473
1011326346_1011326353 30 Left 1011326346 6:86152740-86152762 CCACTCATGTGTTCCTCAGAATG No data
Right 1011326353 6:86152793-86152815 TCTCAGGTTTCTATAGGCCCAGG No data
1011326346_1011326350 14 Left 1011326346 6:86152740-86152762 CCACTCATGTGTTCCTCAGAATG No data
Right 1011326350 6:86152777-86152799 TGTCTGCCTGCTAGGTTCTCAGG No data
1011326346_1011326352 24 Left 1011326346 6:86152740-86152762 CCACTCATGTGTTCCTCAGAATG No data
Right 1011326352 6:86152787-86152809 CTAGGTTCTCAGGTTTCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011326346 Original CRISPR CATTCTGAGGAACACATGAG TGG (reversed) Intergenic
No off target data available for this crispr