ID: 1011326347

View in Genome Browser
Species Human (GRCh38)
Location 6:86152753-86152775
Sequence ACAAGCAGCTGGACATTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011326347_1011326353 17 Left 1011326347 6:86152753-86152775 CCTCAGAATGTCCAGCTGCTTGT No data
Right 1011326353 6:86152793-86152815 TCTCAGGTTTCTATAGGCCCAGG No data
1011326347_1011326356 23 Left 1011326347 6:86152753-86152775 CCTCAGAATGTCCAGCTGCTTGT No data
Right 1011326356 6:86152799-86152821 GTTTCTATAGGCCCAGGATGGGG No data
1011326347_1011326357 24 Left 1011326347 6:86152753-86152775 CCTCAGAATGTCCAGCTGCTTGT No data
Right 1011326357 6:86152800-86152822 TTTCTATAGGCCCAGGATGGGGG No data
1011326347_1011326355 22 Left 1011326347 6:86152753-86152775 CCTCAGAATGTCCAGCTGCTTGT No data
Right 1011326355 6:86152798-86152820 GGTTTCTATAGGCCCAGGATGGG No data
1011326347_1011326352 11 Left 1011326347 6:86152753-86152775 CCTCAGAATGTCCAGCTGCTTGT No data
Right 1011326352 6:86152787-86152809 CTAGGTTCTCAGGTTTCTATAGG No data
1011326347_1011326349 -7 Left 1011326347 6:86152753-86152775 CCTCAGAATGTCCAGCTGCTTGT No data
Right 1011326349 6:86152769-86152791 TGCTTGTGTGTCTGCCTGCTAGG 0: 8
1: 56
2: 80
3: 159
4: 473
1011326347_1011326358 29 Left 1011326347 6:86152753-86152775 CCTCAGAATGTCCAGCTGCTTGT No data
Right 1011326358 6:86152805-86152827 ATAGGCCCAGGATGGGGGTGTGG No data
1011326347_1011326350 1 Left 1011326347 6:86152753-86152775 CCTCAGAATGTCCAGCTGCTTGT No data
Right 1011326350 6:86152777-86152799 TGTCTGCCTGCTAGGTTCTCAGG No data
1011326347_1011326354 21 Left 1011326347 6:86152753-86152775 CCTCAGAATGTCCAGCTGCTTGT No data
Right 1011326354 6:86152797-86152819 AGGTTTCTATAGGCCCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011326347 Original CRISPR ACAAGCAGCTGGACATTCTG AGG (reversed) Intergenic
No off target data available for this crispr