ID: 1011326349

View in Genome Browser
Species Human (GRCh38)
Location 6:86152769-86152791
Sequence TGCTTGTGTGTCTGCCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 776
Summary {0: 8, 1: 56, 2: 80, 3: 159, 4: 473}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011326345_1011326349 22 Left 1011326345 6:86152724-86152746 CCGCTTACGTCTTATTCCACTCA No data
Right 1011326349 6:86152769-86152791 TGCTTGTGTGTCTGCCTGCTAGG 0: 8
1: 56
2: 80
3: 159
4: 473
1011326347_1011326349 -7 Left 1011326347 6:86152753-86152775 CCTCAGAATGTCCAGCTGCTTGT No data
Right 1011326349 6:86152769-86152791 TGCTTGTGTGTCTGCCTGCTAGG 0: 8
1: 56
2: 80
3: 159
4: 473
1011326344_1011326349 26 Left 1011326344 6:86152720-86152742 CCAACCGCTTACGTCTTATTCCA No data
Right 1011326349 6:86152769-86152791 TGCTTGTGTGTCTGCCTGCTAGG 0: 8
1: 56
2: 80
3: 159
4: 473
1011326346_1011326349 6 Left 1011326346 6:86152740-86152762 CCACTCATGTGTTCCTCAGAATG No data
Right 1011326349 6:86152769-86152791 TGCTTGTGTGTCTGCCTGCTAGG 0: 8
1: 56
2: 80
3: 159
4: 473

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011326349 Original CRISPR TGCTTGTGTGTCTGCCTGCT AGG Intergenic
900721020 1:4175864-4175886 TGCTGGTGTGGCTGGCTTCTTGG + Intergenic
900797960 1:4720800-4720822 AGGTTGTGTGGCTGCATGCTCGG + Intronic
902395639 1:16131110-16131132 TGTGTGTGTGTCTGTGTGCTTGG - Intronic
903545278 1:24120119-24120141 GGCTTGTGTGTCTCCCTCCCTGG + Exonic
903736955 1:25535941-25535963 TGCTTTTCTGTCTCCCTACTAGG - Intergenic
905505816 1:38478176-38478198 TGATTCTGTGTCTGCCTCCTGGG - Intergenic
905526224 1:38642008-38642030 TGCTTGTGTCTGTGCTTGCTAGG + Intergenic
905558738 1:38909120-38909142 TGCTTGTGTGTCTGCAGGCTAGG + Intronic
905661315 1:39728265-39728287 AGCTTGTGTGTTTGCCGGCTAGG + Intronic
906067725 1:42994131-42994153 TGTGTGTGTGTCTGTCTGTTTGG - Intergenic
906286834 1:44593063-44593085 CTGTTCTGTGTCTGCCTGCTGGG - Intronic
906593260 1:47048121-47048143 TGCTTGTATTCCTGCCTACTTGG + Intronic
907159767 1:52361495-52361517 TGCTGGTGTGTCTGCCAGGCTGG - Exonic
907962155 1:59293992-59294014 CGCCTGTTTGTCTACCTGCTAGG - Intergenic
908016816 1:59849107-59849129 CGCTAGTGTGTCTGCCCTCTTGG - Exonic
908929955 1:69306282-69306304 CACTTGTGTCTGTGCCTGCTAGG + Intergenic
909263543 1:73526857-73526879 TGCCTATGTGTCTCCCTGCTAGG - Intergenic
909862962 1:80632461-80632483 CACTTGTGTGTCTGCCTACTAGG - Intergenic
910477169 1:87619837-87619859 TGCCTGTGTGTCTGCCTGCTAGG - Intergenic
910478521 1:87634203-87634225 TGCCTGTGTGTCTGCCTGCTAGG + Intergenic
911058593 1:93728798-93728820 CATCTGTGTGTCTGCCTGCTAGG + Intronic
911513069 1:98831697-98831719 TGCTTGAATTTCTGCCTCCTGGG + Intergenic
912002804 1:104856252-104856274 CACTTGTGTGTGTGCCGGCTAGG + Intergenic
913246630 1:116875683-116875705 TGCCTGTGTGTCTGCCTGCTAGG + Intergenic
913511809 1:119569127-119569149 AGCTTGTGCATGTGCCTGCTAGG + Intergenic
913712757 1:121502404-121502426 TTCTTGTGTCTCTGCCTTCGGGG + Intergenic
913973144 1:143431884-143431906 TGTTTCTGTTTCTGCCTACTTGG + Intergenic
914067528 1:144257491-144257513 TGTTTCTGTTTCTGCCTACTTGG + Intergenic
914111625 1:144708863-144708885 TGTTTCTGTTTCTGCCTACTTGG - Intergenic
915081243 1:153354181-153354203 TGCTTGTTTGTTTACTTGCTTGG + Intergenic
915092529 1:153436582-153436604 TGCTCCTGTGTCTGCTTGTTGGG - Intergenic
915141559 1:153771484-153771506 TGCTTGTGCTTCTGCCTCCCAGG + Intronic
915476111 1:156153816-156153838 TGCTCCTGTGTCTGCCTCCCTGG - Intronic
916213774 1:162379084-162379106 TGCTTGGGTGTGTGCATGTTGGG + Intronic
916284687 1:163093528-163093550 TGCCTGTGTGTCTGCCTGCTAGG - Intergenic
916614172 1:166422626-166422648 TGTGTGTGTGTGTGCCTGCTAGG - Intergenic
918937242 1:190937887-190937909 TGCTTGTGTGTCTGTGTTTTAGG - Intergenic
918961368 1:191282552-191282574 TCCTGGTGGGTCAGCCTGCTTGG - Intergenic
919539151 1:198827688-198827710 AGCTTGTGTCCCTGCCCGCTAGG + Intergenic
919539722 1:198831456-198831478 CACTTGTGTGTCTGCCTGCTAGG + Intergenic
919761042 1:201098417-201098439 TTCGTGTGTGTGTGCCAGCTGGG - Intronic
920756885 1:208741055-208741077 TGCTTTTGTCTCTGCCTGCTAGG + Intergenic
920897819 1:210075306-210075328 CACTTGTGTGCCTGCCTGCTAGG + Intronic
921403504 1:214753291-214753313 CGCCTGTGTCTGTGCCTGCTAGG - Intergenic
921673807 1:217955071-217955093 TGCGTGTCTGTGTCCCTGCTTGG - Intergenic
921696199 1:218214093-218214115 CACTTGTTTGTCTGCCTGCTAGG - Intergenic
921893905 1:220379562-220379584 CGCTTATGTGTCTGCCTGGTAGG + Intergenic
921956022 1:220983889-220983911 CGCTTGTGTCTGTGCCTGCTAGG - Intergenic
921991581 1:221372832-221372854 TGCTTGTGTATGTGCCCACTAGG + Intergenic
922700104 1:227754313-227754335 CACCTGTGTGTCTGCCTGCTAGG + Intronic
922755640 1:228095310-228095332 TGCTTGTGTGTGGATCTGCTGGG + Intronic
923008518 1:230070511-230070533 TGCCTGTGTGCCTGCATGCTGGG + Intronic
923109959 1:230882687-230882709 CGCCTGTGTGTTTACCTGCTAGG + Intergenic
923252642 1:232191662-232191684 TGCTTGTGTCTCTGCCCTCTAGG - Intergenic
924311411 1:242747239-242747261 TGCATGTGTGTGTGCATGTTGGG - Intergenic
924449698 1:244166360-244166382 TGCTTGTGTGTGTGGGTTCTGGG + Intergenic
1063357774 10:5417218-5417240 CACCTGTGTGTCTGCCTGCTAGG + Intronic
1063390616 10:5648067-5648089 TGCGTGGGTGTTTGCCTGCGTGG - Intronic
1063390723 10:5648562-5648584 TGCGTGGGTGTTTGCCTGCGTGG - Intronic
1063753089 10:8974567-8974589 TGTGTGTGTGTGTGTCTGCTTGG + Intergenic
1063968413 10:11364402-11364424 TGCCAGTGAGTCTGCCTGGTGGG - Intergenic
1064795848 10:19010221-19010243 TGTTTGTGTCTCTGCCTGATAGG + Intergenic
1064851567 10:19714448-19714470 TGCCTGCATGTCTGTCTGCTAGG + Intronic
1065371474 10:24991415-24991437 CATTTGTGTGCCTGCCTGCTAGG - Intronic
1066212313 10:33252061-33252083 CGCTTGTATATCTGCCCGCTAGG - Intronic
1068258283 10:54542907-54542929 TGTATTTGTATCTGCCTGCTAGG - Intronic
1068429549 10:56913495-56913517 TGCCTATATGTCTGCCTGCTAGG + Intergenic
1068480017 10:57578424-57578446 TGCTTGTGTGTCTTTCTGTATGG - Intergenic
1068607886 10:59026065-59026087 TGCTTGTGTCTCTGCCTGCCAGG - Intergenic
1069209052 10:65733402-65733424 TGCTCATGTCTCTGCCCGCTAGG - Intergenic
1069751641 10:70748861-70748883 TGCTTGGGTCTCAGGCTGCTGGG + Intronic
1070005075 10:72415971-72415993 ATCTTGTGTATCTACCTGCTTGG - Intronic
1070380758 10:75878551-75878573 TGATTGTGTCTGTGCCTGCTAGG + Intronic
1071195390 10:83153428-83153450 TGCTTGTGTGTGTTCCTGCTAGG - Intergenic
1071403635 10:85305148-85305170 CGCGTGTGTGTGTGCATGCTGGG - Intergenic
1071486816 10:86107671-86107693 TGCCTGTGTGTTTGCCTGTTAGG - Intronic
1071867077 10:89746534-89746556 TGCTTGTGTGTGTGCCTGCCAGG + Intronic
1071893825 10:90042175-90042197 TGCTCGTGTGTGTGCCCGCCAGG + Intergenic
1073467464 10:103702600-103702622 TGTGTGTGTGTGTGCATGCTGGG + Intronic
1073762811 10:106648888-106648910 TGCCTGTGTGTCTGCTTGCTAGG - Intronic
1074096478 10:110317971-110317993 CGCTTGTGTGTAGGCCCGCTAGG - Intergenic
1074177983 10:111030203-111030225 TGCTTGTCTCTGTGCCCGCTAGG + Intergenic
1074893304 10:117753468-117753490 TGTGTGTGTGTCTGTGTGCTTGG + Intergenic
1075618489 10:123908519-123908541 TGCATGTCTGTCTCCCTACTAGG - Intronic
1075968311 10:126631787-126631809 TGCCTGTGCCTCTGCTTGCTGGG - Intronic
1076143792 10:128100284-128100306 GGCTTGTGTGTCTGGATGGTGGG - Intronic
1076255044 10:129016544-129016566 TGCATGTGTGTCTGCTTGTGTGG + Intergenic
1076540702 10:131213032-131213054 TGCTTGGCTGCCTGCCTGATGGG - Intronic
1077167061 11:1147905-1147927 TGCTTGTGTGTGTGTTTGCATGG + Intergenic
1077212937 11:1381906-1381928 TCCTTGGGTGTCTGGCTCCTGGG + Intergenic
1077586733 11:3459581-3459603 TGCCTGTGTGCCTGCCTGCTAGG + Intergenic
1077765103 11:5150206-5150228 TGTGTGTGTGTGTGTCTGCTTGG - Intergenic
1077921569 11:6645845-6645867 TGCATGTGCATCTGCCTGCATGG - Intronic
1077992538 11:7424832-7424854 TGCATGTCTGACTGTCTGCTGGG + Intronic
1078113960 11:8426349-8426371 TGCTTGTGCGTCTGCCTGCTAGG + Intronic
1080569197 11:33541107-33541129 TCCTTGTCTGTCTGCCTGTGGGG + Intergenic
1080576837 11:33607571-33607593 AGCTTGTGTGTGTACATGCTTGG - Intronic
1081061316 11:38481500-38481522 TGCCTGTGTGTCTGCCTGCTAGG - Intergenic
1081334236 11:41844137-41844159 TGCTTGTATTTCTGGCTACTGGG - Intergenic
1081342705 11:41947652-41947674 CGCTTCTGTGTATGCCTGCTAGG + Intergenic
1081869481 11:46376826-46376848 TGCTTCTGTGTCTCCCTGGATGG - Intronic
1082900422 11:58243906-58243928 TGCGTGTGTGTCTCCTTGCCTGG + Intergenic
1083350678 11:62026567-62026589 TGCTTTTGTGTCTTGCTGATAGG + Intergenic
1084206102 11:67594045-67594067 TGCTTGTGTGTCTGCTTGCTAGG + Intergenic
1084242732 11:67833614-67833636 CGCCTATGTGTCTGCCTGCTAGG + Intergenic
1084396843 11:68916705-68916727 TGCTTGCGTGGCTGCTTGCATGG + Intronic
1084558294 11:69888271-69888293 TACATGTGTGTTTGCCTGCAAGG - Intergenic
1084830266 11:71763365-71763387 TGCCTGTGTGTCTGCCTGCTAGG - Intergenic
1084927089 11:72522538-72522560 CACTTGTGTGTCTGCCTGCTAGG + Intergenic
1085315704 11:75543676-75543698 CACTTGTGTCTCTGCCTGCTAGG + Intergenic
1085617273 11:78010433-78010455 TGTTTGTGTGTGTGTGTGCTGGG - Intergenic
1085887053 11:80533437-80533459 CACTTGTGTCTCTGCCTGCTAGG + Intergenic
1086395730 11:86413273-86413295 CGCTTGTGTGCCTGCCTGCTAGG + Intronic
1086605937 11:88696287-88696309 TGCTTGTGTCTGTGCCTGCTAGG + Intronic
1086952790 11:92908291-92908313 AGCTGGTGTGTCTCCCTGCAAGG + Intergenic
1087140039 11:94756181-94756203 CGCTTGTGTCTGTGCCCGCTAGG + Intronic
1087327975 11:96746671-96746693 CGCTTGTGTGCGTGCCCGCTAGG - Intergenic
1087335552 11:96839835-96839857 TGCTTGTGTGCCTGCCTGCTAGG + Intergenic
1087477994 11:98661822-98661844 TGCTTGTGTCTATGTCTGTTTGG - Intergenic
1087781852 11:102309887-102309909 CACCTGTGTGCCTGCCTGCTAGG - Intergenic
1087816445 11:102664028-102664050 AGCTTGTGTGTCTGCCTGCTAGG - Intergenic
1088221051 11:107570328-107570350 CGCTTGTGTGTCTGCCTGCTAGG + Intergenic
1088238563 11:107750589-107750611 CGCTTGTGTCTCTGCCCGCTAGG + Intergenic
1088638063 11:111843784-111843806 TGTTTCTGTGTCTGCCTTATTGG - Intronic
1088997675 11:115016037-115016059 TGTTTGTGTGTGTGCGTGTTGGG + Intergenic
1089118213 11:116113153-116113175 TGCTTGTGGATCAGCCTTCTGGG - Intergenic
1089122087 11:116144613-116144635 CACCTGCGTGTCTGCCTGCTAGG - Intergenic
1089122583 11:116147797-116147819 CACCTGTGTGTCTGCCTGCTAGG - Intergenic
1089445094 11:118545617-118545639 GGCTTATGTGACTACCTGCTGGG - Intronic
1089869709 11:121661304-121661326 TGCTTCAGTGTCTGCTTGCTGGG + Intergenic
1090432398 11:126656924-126656946 TGCTTGTGGTCCTGGCTGCTTGG + Intronic
1090776402 11:129969697-129969719 TTCTTGTGTCTCAGCCTCCTGGG - Intronic
1091560541 12:1609428-1609450 TGAGTGTGTGTGTGCCTGCTGGG + Intronic
1091969870 12:4777773-4777795 TGCTTGTGGGCCTTCCTGATGGG + Intronic
1092412969 12:8268314-8268336 TGCCTGTGTGTCTGTCTGCTAGG + Intergenic
1092598698 12:10035195-10035217 CACTTATGTGTCTGCCTGCTAGG + Intronic
1093156157 12:15688520-15688542 TGCTTATGTGCCTGCCTGCTAGG - Intronic
1093285312 12:17252833-17252855 TTCTTGTGCCTCAGCCTGCTGGG - Intergenic
1093503234 12:19836152-19836174 TGCCTGTGTGTCTGCGCACTAGG - Intergenic
1093654323 12:21677347-21677369 TGCTTGTGTCTCTGCCTGGTAGG - Intronic
1093656007 12:21694902-21694924 CGTTTGTGTGTCTGCCTGTTAGG + Intronic
1094249320 12:28341190-28341212 TGCTTGTGTCTCTGCCTGCTAGG + Intronic
1094406431 12:30121254-30121276 TGCTTATGTTTGTGCCTGCTAGG - Intergenic
1094461037 12:30696687-30696709 TGCCTGTGTACCTGCCTGCTAGG - Intergenic
1095234223 12:39777630-39777652 CACCTGTGTGTCTCCCTGCTAGG - Intronic
1095376190 12:41531484-41531506 CTCTTGTGTGTCTGCTTGCTAGG + Intronic
1095692404 12:45104919-45104941 TGTATGTGTGTGTGCCTGATGGG - Intergenic
1095898658 12:47305693-47305715 CACTTCTGTGTCTGCCTGCTAGG + Intergenic
1095964442 12:47857486-47857508 TCCGGGTATGTCTGCCTGCTGGG - Exonic
1096171627 12:49476145-49476167 CACCTGTGTGTCTTCCTGCTGGG - Intronic
1096414466 12:51401617-51401639 CGCTTGTGTCTCTGCCCGCTCGG + Intronic
1096674272 12:53218187-53218209 TGTGTGTGTGTGTGCCTGTTTGG - Intronic
1097131166 12:56811608-56811630 AGCTTGTGTGTCTGCCTGCTAGG + Intergenic
1097343360 12:58464961-58464983 TACTGTTGTGTCTGCTTGCTTGG - Intergenic
1097352408 12:58562842-58562864 TGCTTGTGTGTGTGCCCACTAGG + Intronic
1098253580 12:68593954-68593976 TTCTTGTGTCTCAGCCTCCTAGG + Intergenic
1098396889 12:70028823-70028845 TGCTTAAGTGTGTGCCTCCTAGG + Intergenic
1098467429 12:70803867-70803889 TGCTTGTGTATATGCCTGCATGG + Intronic
1098547937 12:71731785-71731807 AGCTTGTGGGTGTGCCTGCTAGG - Intergenic
1099248390 12:80221370-80221392 TTCTTGTGTCTCAGCCTCCTGGG + Intronic
1099271261 12:80513473-80513495 CGCTTGTGTGTGTGCCCGTTAGG + Intronic
1099315682 12:81079320-81079342 TCCTTATGTGTCTGCCCTCTGGG + Intronic
1099460055 12:82910835-82910857 CTTCTGTGTGTCTGCCTGCTAGG + Intronic
1100266216 12:92978784-92978806 TGCATGTGTGTCTGCATGGGTGG + Intergenic
1101190948 12:102331762-102331784 TGCTTGACTGTCTTCCAGCTGGG + Intergenic
1101455149 12:104824260-104824282 TGCCTGTGTGTCTGCCTGCTGGG - Intronic
1101455729 12:104828088-104828110 TGCTTGTGTGTCTGCTTGCTAGG - Intronic
1101775477 12:107789389-107789411 TGCTGGCATGTCTGCCTACTGGG + Intergenic
1102086961 12:110149835-110149857 CACTTGTGTGTCTGCCTGCTAGG + Intronic
1103224348 12:119274221-119274243 TGTTTGTGTCTGTGTCTGCTAGG - Intergenic
1104382444 12:128319388-128319410 TGTGTGTGTGTCTGTCTGTTGGG + Intronic
1105638644 13:22240302-22240324 CACCTGTGTGTCTGCCTGCCAGG + Intergenic
1105673455 13:22644710-22644732 AGCTTGTGTGTCTGCCTGCTAGG + Intergenic
1105682674 13:22745253-22745275 AGCTTGTGTGTCTGCCTGCTAGG + Intergenic
1105724476 13:23148007-23148029 CGCCTATGTGTCTGCCTGCAGGG + Intergenic
1106112054 13:26785996-26786018 TGTCTGTGTGTCTGCCTACTAGG + Intergenic
1106169823 13:27279567-27279589 TATGTGTGTGTCTGCTTGCTGGG - Intergenic
1106182926 13:27383661-27383683 GGCTTGTGTGTCTGCCTGCTAGG - Intergenic
1106319416 13:28624160-28624182 GGTGTCTGTGTCTGCCTGCTAGG - Intergenic
1106540961 13:30689933-30689955 CCGATGTGTGTCTGCCTGCTAGG - Intergenic
1106541103 13:30690906-30690928 TGCTTGTGTGTTTGTTTACTTGG - Intergenic
1106622597 13:31385544-31385566 TGCTTGTGTGTCTGCTTGTTAGG + Intergenic
1108112962 13:47096746-47096768 TTCTTGTGTGTGTGCCTATTTGG + Intergenic
1108964703 13:56283354-56283376 TGCTTGTAGGTCTGTCCGCTGGG + Intergenic
1109151740 13:58856865-58856887 CACCTGTGTGTCTGCCTGTTAGG + Intergenic
1109421244 13:62115396-62115418 TGCTTGTGTGTCTGCCTACTAGG - Intergenic
1110484303 13:76019994-76020016 TGCTTGTGTTTCTGCCTGCTAGG + Intergenic
1110818048 13:79882916-79882938 CACCTGTGTGTCTGCCTGCTAGG + Intergenic
1111406288 13:87811109-87811131 CACTTGTGTATCTGCCTGCAAGG + Intergenic
1112393779 13:99009679-99009701 TGCTTGTGTGTCTGTGGGTTTGG - Intronic
1112814159 13:103252352-103252374 CACTTGTGTGTCTGCCTGCTAGG + Intergenic
1112941361 13:104866316-104866338 CGCTTGTGTGGCTGCCTGCTAGG - Intergenic
1114494361 14:23122350-23122372 TGCCTGTGGGCCTTCCTGCTGGG - Intergenic
1114924937 14:27384325-27384347 GGCCTGTGTGTCTGCCTGCTGGG + Intergenic
1115124019 14:29971398-29971420 CACTTGTGTGTCTGTCTGCTAGG + Intronic
1116298375 14:43141914-43141936 TGCTTGTGTCTCTGCCCGCTAGG + Intergenic
1117875599 14:60248502-60248524 TGCTTGTGTCTCTGCCCTTTGGG + Intronic
1117902552 14:60550651-60550673 GGCATGGGTGTGTGCCTGCTGGG + Intergenic
1118777427 14:68981624-68981646 TGTTTCTGTGTCTGTCTGCTGGG - Intergenic
1118861190 14:69665009-69665031 TGCTGGTGTGCCTGGCTGCCTGG + Intronic
1118929314 14:70225471-70225493 TGCTTGTGTCTCTGCCCACTAGG - Intergenic
1119000035 14:70873394-70873416 TGCTTGTGTGTGTGCCCGCTGGG - Intergenic
1119406581 14:74402930-74402952 TGCTTCTCTGTCTTCCTGCTGGG + Intergenic
1120126388 14:80748919-80748941 TGCTTGTGTGTTTCTCTTCTGGG - Intronic
1120744662 14:88142664-88142686 TGCCTGTGTGTCTCCCCGCTAGG - Intergenic
1121475683 14:94199874-94199896 CACTTGCGTCTCTGCCTGCTAGG + Intronic
1121725611 14:96146622-96146644 TGCTTGAGTTGCTGCATGCTGGG - Intergenic
1121908295 14:97767233-97767255 AGCTTGTGTCCCTGTCTGCTAGG + Intergenic
1122348125 14:101072940-101072962 TGTTTGTGTGTCTGTATGTTCGG + Intergenic
1122867139 14:104611558-104611580 CCCATGTGTGTCTGCCTCCTAGG + Intergenic
1122938091 14:104969133-104969155 TGCCTCTGTGTCTGCCTCCAAGG + Intronic
1123107006 14:105846337-105846359 AGAATGTGTGGCTGCCTGCTGGG + Intergenic
1123577011 15:21680962-21680984 TGCTTGTTTGTTTGCTTGTTTGG + Intergenic
1123613633 15:22123430-22123452 TGCTTGTTTGTTTGCTTGTTTGG + Intergenic
1124698407 15:31887858-31887880 TGCTTGTGTCTGTGCCCGCTAGG + Intergenic
1125372464 15:38993279-38993301 TCCCTGTGTTTCTGCCTGCCTGG + Intergenic
1125484545 15:40103198-40103220 TGTTTGTGTGTCTGACTGCGAGG - Intronic
1126851623 15:52800714-52800736 TGTGTGTGTGTCCGACTGCTTGG + Intergenic
1127027659 15:54825187-54825209 TGCCTGTGTCTGTGCCCGCTAGG + Intergenic
1127652440 15:61022413-61022435 GGATTGTGTGTGTGGCTGCTGGG + Intronic
1127980518 15:64031573-64031595 TGCTTGTATTTCTTGCTGCTGGG - Intronic
1128046095 15:64618835-64618857 CGCTTGTGTGTCTGCCTGCTAGG + Intronic
1128262450 15:66241809-66241831 TGCTTGTGTCTTTGCGTGTTGGG - Intronic
1128458767 15:67850237-67850259 TGCTGGTGTGTTAGTCTGCTGGG - Intergenic
1128622168 15:69160262-69160284 GGCTTGTGTGTGGTCCTGCTAGG - Intergenic
1128947038 15:71831941-71831963 TTCTTTTGTTTCTTCCTGCTTGG - Intronic
1129319202 15:74764584-74764606 TCCTTGTGTGTCTTCCAACTTGG - Intergenic
1129362592 15:75033723-75033745 TATTTGTGCCTCTGCCTGCTTGG + Intronic
1129993141 15:79982069-79982091 TGCTTGTGCCTCTGCCACCTCGG - Intergenic
1130232161 15:82105359-82105381 TCCTCGTGTGTGTGCCTGATTGG - Intergenic
1130430410 15:83841847-83841869 CACTTGTGTGTGTGACTGCTAGG - Intronic
1130682738 15:86010696-86010718 CGCCTGTGTGTCTGCCAGCTAGG + Intergenic
1130702096 15:86194557-86194579 TGTTTGTGTGTCTGTGTACTGGG + Intronic
1130908985 15:88258030-88258052 CTGTAGTGTGTCTGCCTGCTCGG - Intergenic
1131853559 15:96568056-96568078 TGGGTGTGTGTGTGCCTGCAAGG - Intergenic
1132409474 15:101565712-101565734 TGCAGGTGTCTCTGCCTGGTGGG - Intergenic
1202985879 15_KI270727v1_random:415207-415229 TGCTTGTTTGTTTGCTTGTTTGG + Intergenic
1132545342 16:530525-530547 TGCATGTGTGTCTCGCTGCAGGG + Intronic
1133234322 16:4380801-4380823 TCCTGGCGTGTCTGCCTTCTAGG + Intronic
1133389537 16:5398374-5398396 TGCTTGTGTGTATGCATGTGAGG + Intergenic
1134346682 16:13398112-13398134 CGCTTGTGTCTCTGCCTACTAGG + Intergenic
1134820982 16:17247242-17247264 TGATTGTGTGTCTGCCACCCAGG - Intronic
1135121150 16:19767620-19767642 TGCCTGGGTGTCTGCCCGCTAGG + Intronic
1135548279 16:23380027-23380049 TGTGTGTGTGTCTGTCTGTTTGG + Intronic
1136092842 16:27932937-27932959 TGCTTGTGAGTCTGCAGGTTGGG - Intronic
1136499954 16:30665137-30665159 TGCTTGTGACCCTGACTGCTGGG + Intronic
1137669835 16:50272545-50272567 GGCTGGTGTGTCTTCCTGGTGGG + Intronic
1137732286 16:50697726-50697748 TACTTGTGTGTCTGGCTGCTTGG - Intronic
1137853809 16:51773257-51773279 CGCTTTTGTGTCTGCCTGCTAGG - Intergenic
1138808462 16:60120790-60120812 CGCCTGTGTGTCTGCCTACTAGG - Intergenic
1138824252 16:60299668-60299690 TCCCTGTGTGTTTTCCTGCTTGG + Intergenic
1138849150 16:60605507-60605529 TGCCTATGTATCTGCCTGCTAGG + Intergenic
1139017824 16:62711518-62711540 TGCTTGTGTGTGTGCCCACTAGG - Intergenic
1139064157 16:63291726-63291748 TGCCTGTGTGTCTGCCTGCTAGG - Intergenic
1139990177 16:70933938-70933960 AGCCTTTGTGTCTTCCTGCTTGG - Intronic
1140630632 16:76847832-76847854 TGCTTGTGTGTTTTGATGCTGGG - Intergenic
1142725502 17:1810745-1810767 TGCTTATGTGTCTGCCTGCTAGG - Intronic
1142898716 17:2999053-2999075 TGCTTGCGTATCTGCCTCCCTGG - Intronic
1143110835 17:4551974-4551996 TACCTGTGTTTCCGCCTGCTGGG - Exonic
1143465579 17:7134142-7134164 CACTTCTGTGTCTGCCCGCTAGG + Intergenic
1144320872 17:14118116-14118138 TGCTTGTGTCTGTGCCCGCTAGG + Intronic
1144431000 17:15191614-15191636 GGCTTGTGTGCATGTCTGCTAGG + Intergenic
1144484104 17:15650945-15650967 AGCTTCAGCGTCTGCCTGCTGGG - Intronic
1145353958 17:22119308-22119330 TGCTTGTGTGTCTGCCTGCTAGG + Intergenic
1147386731 17:40087023-40087045 TGCATGTGTGCCTGTGTGCTGGG - Intronic
1147386735 17:40087119-40087141 TGTGTGTGTGTCTGTGTGCTGGG - Intronic
1147386738 17:40087195-40087217 TGTGTGTGTGTCTGTGTGCTGGG - Intronic
1147386746 17:40087371-40087393 TGTGTGTGTGTCTGTGTGCTAGG - Intronic
1148535342 17:48433904-48433926 TGCTTTTGTTTCTTCCTGATTGG - Intergenic
1148746402 17:49920662-49920684 ACCTTGTGTGGCTGCCTCCTGGG + Intergenic
1149990385 17:61379921-61379943 TGCTGGTGTGTGTGACTGTTTGG + Intronic
1150241415 17:63636692-63636714 TGCTAGTGTGGCTGCCTTCTTGG - Intronic
1150603666 17:66673355-66673377 TGCTGGTGAGGCTGGCTGCTTGG - Intronic
1150964940 17:69957292-69957314 TCCTTTTTGGTCTGCCTGCTAGG - Intergenic
1152318023 17:79592151-79592173 TGCATGTGTGTGTGTCTGCAGGG + Intergenic
1152446787 17:80349496-80349518 GGCCCGTGTCTCTGCCTGCTTGG - Intronic
1152560200 17:81074647-81074669 TGCCTCTGTGTCTGCGTGCACGG + Intronic
1152560202 17:81074681-81074703 TGCCTGTGTGTGTGCATGCACGG + Intronic
1152851775 17:82640864-82640886 GTCTTGTGCGTCTGCCAGCTCGG - Intronic
1153713035 18:7819309-7819331 AGCTTGTGTATCTACCTGCTAGG - Intronic
1153852248 18:9106331-9106353 CCCTTCTGTGTCTGCCTGTTTGG + Intronic
1155791126 18:29971889-29971911 CACTTTTGTGTCTGCCTACTAGG + Intergenic
1155923869 18:31633249-31633271 TGCTTGTGTCTCTTCCTGCCAGG - Intronic
1156268100 18:35506470-35506492 TTCTTGTGTGTCTGCCTTGGAGG + Intergenic
1156389633 18:36638488-36638510 TGCCTATCTGCCTGCCTGCTTGG + Intronic
1156514898 18:37671209-37671231 TACTTGTGTGCGTGCCCGCTAGG - Intergenic
1156551955 18:38027639-38027661 TGCCTGTGTGTCTGCCTGCTAGG + Intergenic
1156657738 18:39308769-39308791 TGCTTGTGTGCGTGCCTGCTAGG - Intergenic
1156676158 18:39529492-39529514 TGCCTGTGTGTCCACCTGCTCGG - Intergenic
1157065438 18:44343692-44343714 TACTGGTGTGTCTGCAGGCTAGG - Intergenic
1157535010 18:48451649-48451671 TGCTTGTGTCTCTACCGGCTAGG + Intergenic
1157858955 18:51124208-51124230 TGCTTCTGTGTCTGCCCTCTAGG + Intergenic
1158015263 18:52775752-52775774 CGCCTGTGTGTCTGCCCACTAGG + Intronic
1158187825 18:54791716-54791738 CGCCTGTGAGTCGGCCTGCTAGG - Intronic
1158742840 18:60163890-60163912 TGCTTGAGTTTCTGCTTTCTTGG + Intergenic
1159032434 18:63245087-63245109 TACTGGTGTGTCTGCTTCCTGGG + Intronic
1159215212 18:65383736-65383758 CGCTTGTATGTCTGCCTACTAGG - Intergenic
1159345809 18:67201446-67201468 TGCCTATGTGTCTGCCCTCTAGG + Intergenic
1159416213 18:68152527-68152549 CACTTATGTCTCTGCCTGCTAGG - Intergenic
1159417635 18:68173426-68173448 TGCTTGTGTGTGTGCCCGCTAGG + Intergenic
1159721705 18:71899216-71899238 TGCCTGTGTGTGTGCCTGCTAGG + Intergenic
1160215286 18:76923684-76923706 TGCCTCTGCCTCTGCCTGCTTGG + Intronic
1160552712 18:79705245-79705267 TGCTTGTGTGTGCTCTTGCTGGG + Intronic
1160591174 18:79945439-79945461 AGCTTGTGTGCCTGCCTGCCTGG - Intronic
1161819071 19:6517987-6518009 TGATTGTGTGTATGTCTGCATGG + Intergenic
1162145414 19:8610079-8610101 GGCCTGTGTGTCTGTCTCCTTGG - Intronic
1162639861 19:11999808-11999830 TGCTTGTGTGTCTGCCCACTAGG - Intergenic
1162845113 19:13386447-13386469 TGCTTTTGTGTCTGTCTACGTGG + Intronic
1163564348 19:18041138-18041160 TGTATGTGTGTGTGCCTTCTGGG - Intergenic
1163617055 19:18335547-18335569 AGCTTGTGTGTCTGCCCGCTAGG - Intergenic
1163707298 19:18822327-18822349 TGCTTAAGTGTCTGCCGGCTGGG + Intergenic
1163746382 19:19051213-19051235 TTCTTGTGATTCTGCCTGGTTGG + Intronic
1164556944 19:29260487-29260509 TGTGTGTGTGTGTGCCTACTAGG + Intergenic
1164898408 19:31897346-31897368 TGCCTGCCTGCCTGCCTGCTGGG + Intergenic
1165295863 19:34925541-34925563 GGCTTGTGTGTCTGCTTGCTAGG + Intergenic
1166247026 19:41536593-41536615 CTCCTGTGTGTCTGCCTGCTAGG - Intergenic
1166247594 19:41540062-41540084 CTCCTGTGTGTCTGACTGCTAGG - Intergenic
1166621646 19:44306492-44306514 AGCTTGTGTCTCTGCCTGCTAGG + Intergenic
1167570560 19:50285719-50285741 TGCTTGTATGTATGACTGCTTGG + Intronic
1168184637 19:54691812-54691834 CGCCTGTGTGTCTGCGTGCTAGG + Intronic
1168270457 19:55247108-55247130 TGGTTGTGTCTATGCCTGCAGGG - Exonic
925572377 2:5325748-5325770 CGCTGGCGTGTCTGCCCGCTAGG + Intergenic
925806800 2:7658794-7658816 TGCCTGTGTGTCCGCCCGCTAGG + Intergenic
925839777 2:7980325-7980347 TACTTGTGTCTCTGCCTGCTAGG - Intergenic
925894878 2:8463392-8463414 TGGCTGTGTGGCTGCCTGCGCGG - Intergenic
926014819 2:9441513-9441535 TACTTTTCTGCCTGCCTGCTAGG + Intronic
926139226 2:10358537-10358559 CGCTTCTGTGTGTGCCTGCTAGG - Intronic
926825467 2:16901572-16901594 TGCCTGTTTGTCTGCCCACTAGG - Intergenic
926961728 2:18364891-18364913 TGCTCATGTCTGTGCCTGCTAGG + Intergenic
927000877 2:18792974-18792996 TGCATGTGTGTGTGCCTGCATGG - Intergenic
927262348 2:21104303-21104325 TGCCTGTCTGTCTGTATGCTTGG - Intergenic
928537956 2:32258323-32258345 CGCTTGTGTGTCTGCCTGCAAGG + Intronic
929628482 2:43434494-43434516 CGCTTGTGTGCCTGCGTGCTAGG - Intronic
930492146 2:52088570-52088592 TGCTTGTTTGTATGCCTTCCAGG - Intergenic
930807085 2:55501864-55501886 TGCTTGTGGATCTGCCTGAGTGG + Intergenic
931034778 2:58227664-58227686 TGTGTGTGTGTGTGCCTGCTAGG + Intronic
931470200 2:62531870-62531892 TGCCTGGATGTCTGCCTGCTAGG + Intergenic
932427180 2:71645515-71645537 AACTTGTGTTTCTGCCCGCTAGG + Intronic
932576497 2:72965095-72965117 TGCCTGTGTGTTTGCCTGCTAGG - Intronic
932837717 2:75052770-75052792 TGCGTGTGTGTGTGCAAGCTTGG + Intronic
934177840 2:89592841-89592863 TGTTTCTGTTTCTGCCTACTTGG + Intergenic
934288138 2:91667142-91667164 TGTTTCTGTTTCTGCCTACTTGG + Intergenic
934957026 2:98631508-98631530 CACTTGTGTGCCTGCCTGCTAGG - Intronic
935297843 2:101666019-101666041 TGCTTGTGTCTCTGCCTGTTAGG + Intergenic
935543699 2:104378506-104378528 TGCCTGTGTGTCTGCCGGCTAGG + Intergenic
935882185 2:107575757-107575779 CGCTTGTGTGTCTGCCTGCTAGG - Intergenic
936686111 2:114828765-114828787 TGCATGTGCACCTGCCTGCTTGG - Intronic
936863975 2:117056145-117056167 TGCTTGTGTCTCCGCTCGCTAGG + Intergenic
937882574 2:126879532-126879554 TGCCTGTGTGTATGCGTGCACGG - Intergenic
938030208 2:127985812-127985834 CACTTGTGTGCCTGTCTGCTAGG - Intronic
938582173 2:132656300-132656322 TGCTTGTGTGAATGCCTGTTTGG + Intronic
938983239 2:136546626-136546648 GGCATGTGTGTGTGCCTGGTGGG + Intergenic
939587250 2:144020320-144020342 CGCCTGTGTGTCTGCCTGCTGGG - Intronic
939778347 2:146413340-146413362 GGCCTGTGTTTCTGCCTGCTAGG + Intergenic
939818848 2:146930775-146930797 TGCCTGTGTGTCTGCCTGCTAGG - Intergenic
939938585 2:148322117-148322139 TGCTTATGTATCTGCCTTCTCGG - Intronic
939998745 2:148946283-148946305 TGCTGGGGTCTCTGTCTGCTTGG + Intronic
940478119 2:154192244-154192266 CGCTTGTGTGCCTGCCCGCTAGG + Intronic
941106869 2:161364322-161364344 CACTTGTGTCTTTGCCTGCTAGG + Intronic
941186227 2:162324548-162324570 TGCCTCTGTGTCTGCCTGCTGGG + Intronic
941196223 2:162455400-162455422 TTTTTGTGTGTATGTCTGCTGGG + Intronic
941974369 2:171386846-171386868 CACCTGTGTGTCTGCCTGCTGGG - Intronic
942061498 2:172232242-172232264 TGTGTGTGTGTGTGCATGCTGGG + Intergenic
942240289 2:173957303-173957325 TGGATGTGTGTATGTCTGCTTGG - Intronic
942327596 2:174788772-174788794 CATCTGTGTGTCTGCCTGCTAGG - Intergenic
942708010 2:178799268-178799290 CGCTTGTGTGTCTGCCTACTAGG - Intronic
942983143 2:182106332-182106354 TGCTCGTTTGTATGCCTGCTAGG - Intronic
944015081 2:195026399-195026421 TGCATGTGTGGGTGCCTTCTGGG - Intergenic
944306842 2:198188676-198188698 TGCTTATGTGTGTGCCCACTAGG - Intronic
944628514 2:201597547-201597569 TGCTTGGGTTTCTCTCTGCTTGG + Intronic
944728390 2:202495498-202495520 CGCCTGTGTGTCTGCCTGCTAGG + Intronic
945207023 2:207343164-207343186 TGTGTGTGTGTGTGCCTGGTGGG + Intergenic
946370997 2:219281219-219281241 TGTCTGTGTGTGTGCCTGGTAGG - Intronic
946706013 2:222459600-222459622 TGCATGTGTGTGTGCGTGCATGG + Intronic
947360407 2:229340279-229340301 TGGTTGTGTGTGTGTCTGGTGGG - Intergenic
947820435 2:233065244-233065266 TGCATGTTTGTCTACCTGGTAGG + Intronic
947906398 2:233766431-233766453 TACCTGTGTGTCTGCCTGCTAGG + Intronic
948124665 2:235555998-235556020 TCCTTGTGTTTCTGCCTGTGGGG + Intronic
948302690 2:236919929-236919951 TGCTTGCGTGTCTGCCTGCTAGG + Intergenic
948337644 2:237223274-237223296 TGCATGTGTGTGTGCATGCAAGG - Intergenic
948525315 2:238567543-238567565 TGCTTGTGTGCCTGCCTGCTGGG - Intergenic
948672602 2:239578105-239578127 TGCTCGTGTGTCTGGCTGGGCGG - Intergenic
948948323 2:241233159-241233181 TGCTGGGGTGTCTGCTTCCTAGG - Intronic
1168754290 20:305298-305320 TACCTGTGTGTCTGCCTGCTAGG - Intergenic
1169011660 20:2256203-2256225 TGCTGCTGTGGCTGCCAGCTGGG - Intergenic
1169346367 20:4831243-4831265 TGCATGTGTGTGTGCATGGTGGG - Intergenic
1169827522 20:9785943-9785965 TGGTTGGGTGTCTGACTGATAGG - Intronic
1169901986 20:10562494-10562516 CGCCTGTGTGTGTGCCCGCTAGG + Intronic
1170243521 20:14195585-14195607 TGTGTGTGTGTCTGCCTGCTAGG - Intronic
1170271006 20:14527240-14527262 TGCTTCTGTGTTTGCCTGCTAGG + Intronic
1170446526 20:16433569-16433591 TGTGTGTGTGTCTACATGCTGGG - Intronic
1170486004 20:16816908-16816930 TGCTTATGTTTCTGCCCGCTAGG + Intergenic
1170504766 20:17013838-17013860 TGCTTGATTGACTGGCTGCTTGG - Intergenic
1171517598 20:25750398-25750420 GACCTGTGTGTCTGCCTGTTAGG + Intergenic
1171564216 20:26163433-26163455 CGCTTGTGTGTCTGCCTGCTAGG + Intergenic
1172633898 20:36396317-36396339 TGCGTGTGTGTGTGTGTGCTGGG - Intronic
1173099869 20:40076107-40076129 TGCTTGTGTCTCTTAGTGCTTGG - Intergenic
1173616210 20:44404862-44404884 TGCGCGTGTGTGTGACTGCTTGG + Intronic
1174126701 20:48311826-48311848 CGCCTGTGTGTCTGCCCACTAGG + Intergenic
1174432317 20:50479287-50479309 CACTTGTGTCTCTGCCTGCTAGG + Intergenic
1174557270 20:51404879-51404901 TGCTTGTGAGTCTGCTGTCTGGG - Intronic
1175511230 20:59527640-59527662 TACTTGTGTGTCTGCTTGCTAGG - Intergenic
1175857718 20:62131626-62131648 TGCTTGCGTTTCTGCATGATGGG + Intronic
1176064965 20:63189542-63189564 TGCCTGTGTGTGTGCCTGTGTGG - Intergenic
1176933640 21:14842339-14842361 CGCCTGTGTGTCTGCCCGCTAGG + Intergenic
1177609038 21:23421992-23422014 TGTTTGTTTGTTTGCTTGCTTGG - Intergenic
1177882196 21:26707470-26707492 TGCATCTGTGTTTGCCTCCTAGG + Intergenic
1177912439 21:27049483-27049505 CACTTGTGTGCCTGCCTGCTAGG - Intergenic
1178195848 21:30344508-30344530 TGCTTGTGTGCATGCCCACTAGG + Intergenic
1178384497 21:32138258-32138280 TGCTTGTGTCTGTGCCCGCTAGG - Intergenic
1178815556 21:35925865-35925887 AGCTTGTGTGTATGTCTGCCAGG - Intronic
1179246518 21:39638281-39638303 CACCTGTGTGTCTGCCTGCTAGG - Intronic
1179790422 21:43753084-43753106 TGCCTATGTGTGTGCCTGCAAGG - Intronic
1180892115 22:19296936-19296958 CACCTGTGTGTCTGCCAGCTAGG + Intergenic
1180930475 22:19587146-19587168 CACTTCTGTGTCTGCCTGCTAGG + Intergenic
1181451709 22:23027051-23027073 TGCCTGTGTGTTTGCCTGCTAGG + Intergenic
1181519850 22:23439602-23439624 TGCATCTTTGTCAGCCTGCTAGG + Intergenic
1182434390 22:30321093-30321115 TGCCTGAGTGTCCGCCTGCTGGG - Intronic
1182849689 22:33461719-33461741 TGCCTGTGTGTGTGCGTGCCAGG - Intronic
1182994668 22:34801256-34801278 CGCTTATGTCTCTGTCTGCTAGG - Intergenic
1183134400 22:35872770-35872792 TGCCTGTATGTCTGCCCGCTAGG + Intronic
1183732047 22:39623926-39623948 TGTTTGTGTGTGTGCCTGTGAGG + Intronic
1183810301 22:40251066-40251088 TGCCTGTGTGCCTGACAGCTTGG + Intronic
1184947570 22:47814566-47814588 TGATTGTGTGTGTGCATGCATGG + Intergenic
1185259962 22:49856238-49856260 TGCTTGCCTCTCTGCCTGCTGGG + Intronic
949576282 3:5341932-5341954 TGTGTGTGTGTCTGGCTGATTGG + Intergenic
949806299 3:7959330-7959352 GACTTGTGGGTCTGCCTGCTAGG + Intergenic
950076331 3:10189799-10189821 GGCTTGTGTGTCTGCTCTCTTGG + Intronic
950308411 3:11934867-11934889 TTCTTGTGTCTCAGCCTGCCAGG + Intergenic
950646108 3:14377806-14377828 TGCCTGTGTGCCTGCAAGCTAGG + Intergenic
951401411 3:22236812-22236834 TCCTTTTGTGTCTGGCTTCTTGG + Intronic
951549356 3:23861594-23861616 AGCTTGTGTGTCTTCCTGCTAGG - Intronic
952298814 3:32085868-32085890 GGCTTGTGTGTGTGGCTGCTAGG + Intergenic
952564243 3:34635601-34635623 TGCTTGTGTGCCTGCCTGCTAGG + Intergenic
954033491 3:47837218-47837240 TGAATGTGGGTCTGCCTGCTGGG + Intronic
954308737 3:49747926-49747948 TGCTGCTGTGTCCGCCTACTTGG + Exonic
954609894 3:51938847-51938869 TCCTGGTGTGTCTGCCTGGTGGG - Intronic
954717815 3:52535046-52535068 AGCCTGTGTGTGTGCATGCTTGG + Intronic
954910713 3:54105012-54105034 TGCTTGTGGTTCTGGCTACTTGG - Intergenic
954922497 3:54203828-54203850 TGCCTGCGTGTCTGCTTGCTAGG + Intronic
955480544 3:59385219-59385241 CACCTTTGTGTCTGCCTGCTAGG - Intergenic
955832970 3:63024267-63024289 TCATTGTATGTCTGCCTGCTGGG - Intergenic
956194073 3:66634875-66634897 CACCTGTGTATCTGCCTGCTAGG - Intergenic
956229660 3:66998892-66998914 TGTTTGTGTGTCTGCTTGCTAGG - Intronic
957058078 3:75459507-75459529 TGCCTGTGTGTCTGCCTTCTAGG + Intergenic
957758372 3:84522588-84522610 CACTTGGGTGTCTGCCTGCTGGG - Intergenic
957980320 3:87501251-87501273 TGCCTGTCTTTCTACCTGCTGGG + Intergenic
957991028 3:87627659-87627681 TGCTTGTGTGTTTGCCCGCTAGG - Intergenic
958074533 3:88658475-88658497 TGCTTGTGTCTCTGCCCACTAGG + Intergenic
958665545 3:97132563-97132585 TGCTTGTGTTCCTGCCTGAAAGG + Intronic
959186943 3:103056776-103056798 TCCCTGTGTCTGTGCCTGCTAGG - Intergenic
959269770 3:104192565-104192587 CGCTTGTGTGTCTGTCGGTTAGG + Intergenic
959583401 3:108004211-108004233 TGCTTGTGTGTCTGCCCGCTGGG - Intergenic
960023983 3:112988008-112988030 CACTTGTGTGTCTGCCTGCTAGG + Intergenic
960415764 3:117383205-117383227 CACCTGTGTGTCGGCCTGCTAGG - Intergenic
960490548 3:118312473-118312495 AGTTGGTGTGTCTGCCTACTGGG - Intergenic
960877897 3:122315245-122315267 TGCTTGTGTGTGTGCCCGCTAGG - Intergenic
961072268 3:123943987-123944009 TGCCTGTGTTTCTGACTGATTGG - Intronic
961106772 3:124249315-124249337 TGCTTGTGTGGCTGCTGCCTTGG - Intronic
961295375 3:125880209-125880231 CGCCTGTGTGTCTGCCTGCTAGG - Intergenic
961387934 3:126534889-126534911 TGCTGGTCTGTCTCCCGGCTGGG - Intronic
961531301 3:127542000-127542022 TGCCTGCCTGTCTGTCTGCTTGG - Intergenic
961890531 3:130126968-130126990 TGCCTGTGTGTCTGCCTGCTAGG + Intergenic
962095144 3:132285402-132285424 CGCTGGTGTGTCTGCCCACTAGG + Exonic
963046760 3:141108220-141108242 TGCCTCTCTGTCTGCCTGCTTGG - Intronic
963445108 3:145395512-145395534 CACCTATGTGTCTGCCTGCTAGG - Intergenic
964308056 3:155361912-155361934 TGCTTGTGTGCATGTCTGTTAGG + Intergenic
964358540 3:155871238-155871260 GGCTTGTGTGTCTGCGTGTCGGG + Intronic
965171182 3:165266077-165266099 TGTGTGTGTGTCTGCGTGTTTGG + Intergenic
965185302 3:165455075-165455097 TGCTTGTGTCTCTGCCCACTAGG + Intergenic
965339934 3:167477474-167477496 TGCGTGTGTGTTTGTCTGTTGGG - Intronic
965361202 3:167740721-167740743 TGCGTGTGTGTGTGCGTGCATGG + Intronic
965535051 3:169814448-169814470 CGCTTGTGTCTGTGCCTACTAGG + Intergenic
966257571 3:177934835-177934857 TGTTTGTTTCTCTGCCTGCTAGG - Intergenic
966581713 3:181574634-181574656 TGTTTGTTTGTTTGCTTGCTTGG + Intergenic
968548131 4:1208871-1208893 TGTGTGGGTGTCTGCCTGGTGGG - Exonic
968974561 4:3814427-3814449 TGCTTTTGGGTCTGCCGGCTGGG - Intergenic
969001914 4:3989380-3989402 TGCCTGTGTGTCTGCCTGCTAGG + Intergenic
969042398 4:4309546-4309568 TGTTTCTGTTTCTGCCTACTTGG - Intronic
969337996 4:6522822-6522844 TGTTTGTCTGTCTCCCTCCTGGG - Intronic
969506612 4:7591893-7591915 TGCTTGTGTGTCAGCCTCCATGG + Intronic
969752090 4:9119153-9119175 TGCCTGTGTGTCTGCCTGCTAGG - Intergenic
969812002 4:9655428-9655450 TGCCTGTGTGTCTGCCTGCTAGG - Intergenic
970233415 4:13933920-13933942 CACTTGTGTGTATGCCTGCTAGG + Intergenic
970234407 4:13944277-13944299 CACTTCTGTGTCTGCCTGCTAGG - Intergenic
970656531 4:18236537-18236559 TGCCTCTGTGTCTGCTTTCTAGG - Intergenic
970697596 4:18696408-18696430 TGCTTGTGTGTGTGCCTGCTAGG + Intergenic
970762178 4:19503271-19503293 TGCTTGTGTGTGTGTTTGTTTGG - Intergenic
972091752 4:35295190-35295212 TGTGTGTGTGTGTGTCTGCTGGG + Intergenic
972108607 4:35525837-35525859 CCCTTGTGTCTGTGCCTGCTAGG + Intergenic
972394734 4:38649181-38649203 CGCTTGTGTCTCTGCCTGCTAGG - Intergenic
972497661 4:39648938-39648960 TGCTGGTTTGGCTGGCTGCTTGG + Intergenic
972917828 4:43903140-43903162 CGCTTGAGTGTGTGCATGCTAGG - Intergenic
973057475 4:45678983-45679005 TGCTTGCTTCTCTGCCTGCTGGG + Intergenic
973936336 4:55850453-55850475 TGCTTGTGTCTCTGCCTGCTAGG + Intergenic
974303260 4:60097946-60097968 TGCTTGTGTGCCTGCCCACTAGG - Intergenic
974669739 4:65014344-65014366 CGCTTGTGTCTCTGCCAGCTAGG + Intergenic
974704171 4:65489959-65489981 TGCTTGTTTATTTGCTTGCTTGG - Intronic
975905976 4:79212507-79212529 TGCTTGTTTGTTTGCTTCCTGGG + Intergenic
976293619 4:83447731-83447753 TGCTTGCGATTCTGGCTGCTGGG + Intronic
977756913 4:100682577-100682599 AGCACTTGTGTCTGCCTGCTAGG - Intronic
978162749 4:105568745-105568767 TGTATGTGTGCCTGCCTGGTTGG + Intronic
979122019 4:116915135-116915157 TACTTTTGTGTCTGCATGCTTGG + Intergenic
979140142 4:117162335-117162357 CACTTGTTTGTCTGCCTCCTAGG - Intergenic
979859486 4:125676257-125676279 CGCTTGTGTTTGTGCCCGCTAGG - Intergenic
979860119 4:125682992-125683014 TGCTTGTGTGTTGGCCAGCGAGG + Intergenic
979862166 4:125707478-125707500 CGCCTGTTTATCTGCCTGCTAGG + Intergenic
980286346 4:130782920-130782942 TTCTTGTGTGCCTGCCTGCTAGG - Intergenic
980485401 4:133450913-133450935 TGCTTGTGTGCGTGCCCACTAGG - Intergenic
980716462 4:136636269-136636291 TGCCTGTGTGTCTGCCTGTTAGG - Intergenic
980731673 4:136832233-136832255 TGCTTGTGGCTGTGCCTGCTAGG + Intergenic
980823596 4:138047231-138047253 TGCTTGTGTCTCTGCCTGCTAGG - Intergenic
981210223 4:142094597-142094619 TGGTTATGTGTCTGCCTCCCTGG - Intronic
982319907 4:154067203-154067225 TGCTTGGGTGCATGTCTGCTAGG + Intergenic
982504133 4:156196786-156196808 CACTTGTGTCTGTGCCTGCTAGG - Intergenic
982781891 4:159500047-159500069 TGCATGTGTGTTTGTGTGCTGGG + Intergenic
982947750 4:161647885-161647907 TGCCTGTGTGTCTGCCTGCTGGG - Intronic
983145989 4:164215393-164215415 TGCTTGTGTGTCTGCCTGCTAGG + Intronic
983402684 4:167285310-167285332 TGTTTGTCTGTATGCCTGTTTGG + Intergenic
983717642 4:170805085-170805107 TGCCTGTGTATGTGCCTGCTAGG - Intergenic
984261221 4:177445135-177445157 TGCTTGTGCGTCTGCCTGCCAGG - Intergenic
984263679 4:177471351-177471373 CGCCTGCGTGTCTACCTGCTAGG + Intergenic
984271853 4:177557502-177557524 CGCTTGTGTGTCTGCCCGCTAGG - Intergenic
984743813 4:183193929-183193951 TGCCTGCCTGCCTGCCTGCTGGG + Intronic
985198086 4:187453925-187453947 TGCTTGTTTGTGTTCATGCTTGG + Intergenic
985271214 4:188196781-188196803 GGGTTGTGTCTGTGCCTGCTAGG - Intergenic
985689504 5:1299269-1299291 TGCGTGTGTCTCTGCCCGCTAGG - Intergenic
986365351 5:7023247-7023269 CACCTGTGTGTCTGCCTGCTAGG + Intergenic
986770903 5:10972449-10972471 TGCTTGTGTGTCTGTGTGTGTGG - Exonic
986992660 5:13571980-13572002 TTATTGTGTGTGTGGCTGCTGGG + Intergenic
987673429 5:21044441-21044463 TGCCTATGTGTCTGCCTGCTAGG + Intergenic
987969034 5:24918120-24918142 TGTGTGTGTGTCTGCCAGCCTGG - Intergenic
988038131 5:25853673-25853695 TGCCTGTGTGTCTGCCTGCTAGG + Intergenic
988086725 5:26483864-26483886 CGTCTGTGTGTCTGCCTGTTAGG - Intergenic
988139470 5:27217707-27217729 CGCCTGTGTGTCTGCCGGCTAGG - Intergenic
988791734 5:34614683-34614705 TGCCTGTGTTTCTGCCTACTTGG - Intergenic
988995991 5:36715368-36715390 TGCATGTGTGTATGTGTGCTGGG - Intergenic
990698276 5:58446797-58446819 TGCTTGTGTGTGTACCCTCTAGG + Intergenic
990792383 5:59496282-59496304 TGCTTGTGTCTCTACCCGCTAGG + Intronic
991115220 5:62946830-62946852 TGCTTGTGTCTCTGCCTACTAGG - Intergenic
991435006 5:66588975-66588997 TGTCTGTCTGTCTTCCTGCTAGG - Intergenic
992093620 5:73340448-73340470 CGCTTGTGTCTCTGCCTGCTAGG - Intergenic
992672779 5:79076320-79076342 TGCTTGTGTTTGTGTTTGCTAGG + Intronic
992827650 5:80566955-80566977 CCCGTGTGTGTCTGCCTGCAGGG + Intronic
993143867 5:84069864-84069886 TGCTTGTGTGTGTGCCCACTAGG - Intronic
993188064 5:84645752-84645774 CGCTTGTATGTGTGCCTGCTAGG - Intergenic
993302047 5:86223703-86223725 TGCTTGTGTGTGTGTCCGCTAGG - Intergenic
993345238 5:86774780-86774802 TGTGTGTGTGTTTGTCTGCTAGG + Intergenic
993995094 5:94713155-94713177 TGCTTTTGAGTCTGCTTTCTGGG + Intronic
994329672 5:98490405-98490427 CACCTGTGTGTTTGCCTGCTAGG - Intergenic
994661619 5:102661048-102661070 TGCTTGTGACTCTGCCTGCTAGG - Intergenic
995011037 5:107257479-107257501 TGTGTGTGTGTGTGCATGCTAGG - Intergenic
996537010 5:124587994-124588016 TGTGTGTGTGTGTGCATGCTGGG - Intergenic
996569151 5:124913301-124913323 CGCCTGTGTGTCTGCCTGCTAGG + Intergenic
997074524 5:130656837-130656859 TGCATGTGTGTGTGTCTGTTGGG + Intergenic
997139299 5:131361957-131361979 TGTCTATGTGTCTGCCTGCTAGG + Intronic
997400483 5:133598212-133598234 TCCTTGTGTGTGTGCATGCGAGG + Intronic
997661947 5:135595896-135595918 TGCTTGTGATCGTGCCTGCTAGG - Intergenic
997932154 5:138081654-138081676 TGCTTGTGGGCCTCTCTGCTTGG - Intergenic
998131443 5:139653365-139653387 AGCCTGTGTGTCTCCATGCTGGG + Intronic
998556037 5:143124630-143124652 TGCTTCTGTGTTTGCCCTCTTGG - Intronic
999103778 5:149050599-149050621 TGCTTATCTGTCTGTCAGCTTGG - Intronic
999933394 5:156458159-156458181 TGCCTGCCTGCCTGCCTGCTGGG - Intronic
1000167962 5:158673481-158673503 CACTTGTGTGTTTGCCTGCTAGG + Intergenic
1000470241 5:161631266-161631288 TGCTTGTGTCTATGCCTGCTAGG + Intronic
1000532798 5:162444572-162444594 CACCTGTGTGTCTGCCTGCTAGG - Intergenic
1001181124 5:169521724-169521746 TGTCTGTGTGTCTGCCTACTAGG - Intergenic
1001753828 5:174150993-174151015 GGCTTGGGAGTCTGACTGCTGGG + Intronic
1002687812 5:181028146-181028168 CACCTGTGTGTCTGCCTGCTGGG + Intergenic
1003131187 6:3396585-3396607 TGCCTGTGTGCCTCCCTGCTAGG - Intronic
1003314581 6:5000922-5000944 TGCTTGTTCTTCTGCATGCTTGG - Intronic
1003809935 6:9768193-9768215 CACCTGTGTGTCAGCCTGCTAGG + Intronic
1004064285 6:12227831-12227853 TTCTTGTCTGTCTGCCTTCTGGG - Intergenic
1004316168 6:14589888-14589910 TGCTTGGGTGAATGTCTGCTTGG - Intergenic
1004543750 6:16576414-16576436 TCCTTGTGTCTTTGCTTGCTTGG - Intronic
1004953652 6:20702696-20702718 CACTTGTGTGTTGGCCTGCTAGG + Intronic
1005535793 6:26754932-26754954 CGCTTGTGTCTGTGCCCGCTAGG + Intergenic
1005794796 6:29348180-29348202 CACCTGTGTGTCTGCCTGCTGGG + Intergenic
1006208891 6:32375806-32375828 CGCTTCTGTCCCTGCCTGCTAGG - Intergenic
1006395083 6:33781978-33782000 TGAGTGTGTTTCTGCATGCTGGG + Intronic
1006787236 6:36676653-36676675 TGCTTGTGTGAGTGTGTGCTGGG + Intronic
1007251465 6:40497988-40498010 TTCTGGGGTGTCTGCCTACTGGG + Intronic
1007768619 6:44176481-44176503 TCCCTGAATGTCTGCCTGCTGGG - Intronic
1007854879 6:44845638-44845660 CGCTTGTGTGTGTGCCCACTAGG - Intronic
1008509894 6:52266496-52266518 TGTTTGTTTGGCTCCCTGCTTGG - Intronic
1008727700 6:54441930-54441952 TGCCTGTGTGTGTGCCTGCTGGG + Intergenic
1009006822 6:57798581-57798603 CGCTTGTGTCTGTGCCCGCTAGG + Intergenic
1009009035 6:57821344-57821366 CGCTTGTGTCTGTGCCCGCTAGG + Intergenic
1009543738 6:64999628-64999650 CACATGTGTGTCTGCCTGCTAGG - Intronic
1009725176 6:67529464-67529486 GGATTGTGTGTGTGCCTCCTAGG + Intergenic
1009967122 6:70589570-70589592 TGATTGTGTTGCTGCGTGCTAGG + Intergenic
1011191155 6:84729745-84729767 TGTTTTTGTGTCTGTCTTCTTGG + Intronic
1011325759 6:86148912-86148934 TGCTCGTGTGTCTGCCCACTAGG + Intergenic
1011326349 6:86152769-86152791 TGCTTGTGTGTCTGCCTGCTAGG + Intergenic
1012072406 6:94639747-94639769 CGCTTGTGTGTCCGCCTGTCAGG - Intergenic
1012606773 6:101167738-101167760 CACTTGTGTGTTTGCCTGCTAGG - Intergenic
1013112977 6:107079017-107079039 TGCTTGTGTGCCTGCCTGCTAGG - Intronic
1013561464 6:111309523-111309545 CGCTCGTGTGTCTGCCCACTAGG + Intronic
1013631251 6:111988177-111988199 TCTTTGTGTGTCTGCGTCCTTGG + Intergenic
1014492793 6:122082698-122082720 CGCCTGTGTGTCTGCCCGCTAGG + Intergenic
1014620473 6:123661028-123661050 TGCTTGTGTCTGCGCCTGCTAGG + Intergenic
1015168353 6:130224222-130224244 CGCTTGTGTCTGTGCCCGCTAGG + Intronic
1015729577 6:136334518-136334540 CGCTTGTGTGCCTGCTTGCTAGG - Intergenic
1016102876 6:140124759-140124781 TGTGTGTGTGTGTGCCTGTTTGG + Intergenic
1016557279 6:145352991-145353013 TGCTTGTGTCTGTGCCTGCTAGG + Intergenic
1017195169 6:151692701-151692723 TGATGGTGTGCCTGCCTTCTGGG + Intronic
1017339338 6:153302335-153302357 CACTTCTGTGTCTCCCTGCTAGG + Intergenic
1017980106 6:159393987-159394009 TGCTTGTGTGTGTGCCTGCTAGG - Intergenic
1018265839 6:162023631-162023653 CGTCTGTGTGTCTGCCTGCTAGG + Intronic
1019468083 7:1201486-1201508 CACCTGTGTGTCTGCCCGCTAGG - Intergenic
1019591409 7:1836680-1836702 TGCATCTTTGTCAGCCTGCTAGG - Intronic
1020768481 7:12356230-12356252 TACCTGTGTGTCTGCTTGCCTGG - Exonic
1021009374 7:15442806-15442828 TGCTTGTGTCTCTGCCTGCTAGG - Intronic
1022165542 7:27756899-27756921 TTCTGGTGTATCTGCATGCTGGG - Intronic
1022312508 7:29210394-29210416 TGCCTGTGTGTGTACGTGCTGGG - Intronic
1022829100 7:34046793-34046815 TGCATGTGTTTCTTCCTGCATGG - Intronic
1022877011 7:34544641-34544663 CACTTGTGTATCTGCCTGCTAGG - Intergenic
1023121302 7:36911667-36911689 TGCTTTTGGGTCTGGCTTCTTGG - Intronic
1023307831 7:38849718-38849740 TGCTTGTGTCTCTGCCCACTAGG + Intronic
1023606952 7:41939716-41939738 TTCTGCTGTGTCTGCCTGTTTGG - Intergenic
1024008534 7:45246200-45246222 TGGTTGTGAGGCTGCCAGCTGGG - Intergenic
1024039708 7:45542637-45542659 TGTGTGTGTGTATGCCTGTTTGG + Intergenic
1024249703 7:47496758-47496780 TGCAGGTGTCCCTGCCTGCTTGG - Intronic
1024267654 7:47619123-47619145 TGCTTGTGTGTCTGCCTGCTAGG - Intergenic
1024268163 7:47622320-47622342 GGCTTGTGTGTCTGCCTGGTAGG + Intergenic
1024643897 7:51355615-51355637 TGCTTGTGTCTCTTCCCACTAGG + Intergenic
1025104795 7:56162119-56162141 TGCTTGTGTGTGTGCCTGCTGGG - Intergenic
1025273513 7:57550783-57550805 CGCTTGTGTGTCTGCCTGCTAGG - Intergenic
1026111096 7:67459489-67459511 TGCTTGTGTCTATGCCCACTAGG + Intergenic
1026248377 7:68644735-68644757 CGCTTGTGTGTGTGTCTGCTAGG - Intergenic
1026313894 7:69211496-69211518 TGCTTGTGTGTGTGCCTGCTGGG - Intergenic
1027456791 7:78402229-78402251 TGTATGTGTGTCTGCCTACCTGG + Intronic
1027931818 7:84546697-84546719 TGCTTGTGTCTGTGCCCACTAGG + Intergenic
1029033186 7:97490424-97490446 CGCTTGTGTGTCTGCCTGTTAGG - Intergenic
1029704130 7:102266937-102266959 TGCATGTGTACATGCCTGCTAGG + Intronic
1030101765 7:105953016-105953038 TGCTTGTGTGTCTGCCTGCTAGG - Intronic
1030652692 7:112132571-112132593 TGCTTGTGTGTATGCATGCCTGG - Intronic
1031179361 7:118394699-118394721 AGCTTGTGTGTCGGCCTGCAAGG + Intergenic
1031232284 7:119123481-119123503 CATTTGTGTGTCGGCCTGCTAGG - Intergenic
1031750334 7:125563741-125563763 CACCTGTGTGTGTGCCTGCTGGG - Intergenic
1031810180 7:126357821-126357843 TGCTTGTGTGTATGCATGTGTGG - Intergenic
1031815347 7:126426918-126426940 TCCATGTGTGTCAGCCTGCAAGG - Intergenic
1032189509 7:129756091-129756113 TGCTTGTGTGTGTGCGTGCATGG + Exonic
1032638995 7:133743879-133743901 GGTTGGTGTGTCTGCCTCCTAGG + Intronic
1033418543 7:141185629-141185651 TGCTTGTGTGTCTTCTGGCTAGG + Intronic
1033731865 7:144188032-144188054 TCCTTGCTTGTCGGCCTGCTAGG + Exonic
1033742714 7:144286615-144286637 TCCTTGCTTGTCGGCCTGCTAGG + Intergenic
1033751188 7:144362999-144363021 TCCTTGCTTGTCGGCCTGCTAGG - Exonic
1034099307 7:148437535-148437557 CACTTGTGTATCTGACTGCTAGG + Intergenic
1035297371 7:157874695-157874717 TGCATGAGTGTGTGTCTGCTTGG - Intronic
1035339770 7:158152722-158152744 CACTTGTGTGTGTGCCTGCCAGG - Intronic
1035358790 7:158296190-158296212 TGCTTGTGTCTCTGCCTGCTAGG - Intronic
1036635215 8:10545922-10545944 TGCTTGCGTGTGTGAATGCTGGG + Intronic
1037760385 8:21738017-21738039 TGTTTGTGTGTCTGCGAGTTTGG - Intronic
1038701332 8:29852271-29852293 GGCTTGTGTGTTTGTCTGGTGGG - Intergenic
1039086330 8:33783695-33783717 CACTTTGGTGTCTGCCTGCTAGG + Intergenic
1039147587 8:34466005-34466027 TGCTTCCGTCTCTGCCTGATAGG + Intergenic
1039615819 8:38954230-38954252 TGCTTCTGTCTCTGCCCCCTTGG - Intronic
1039865715 8:41499693-41499715 CACCTGTTTGTCTGCCTGCTGGG + Intronic
1040652540 8:49465223-49465245 CGCCTGTGTGTCTGCCTGCTAGG - Intergenic
1041312314 8:56529556-56529578 TGCCTGTGCTTCTGCCTACTGGG - Intergenic
1041586226 8:59523301-59523323 TGGTTGTGTGCATGCCCGCTAGG - Intergenic
1041586767 8:59529802-59529824 TGCCTGTCTGTCTGCCTGGCTGG + Intergenic
1041934680 8:63322234-63322256 CACTTGTGTGACTGCCTGCTAGG - Intergenic
1041984160 8:63900557-63900579 TGCTTGAGTGTCTGCACCCTAGG + Intergenic
1042159240 8:65875293-65875315 TGCTTGTATGTGTGTCTGCTAGG + Intergenic
1042458194 8:69029783-69029805 TGCTTCTGTGTCTGCATGCTGGG + Intergenic
1042598160 8:70471517-70471539 TGGCTGTGTGTCTGCCCACTAGG - Intergenic
1043311014 8:78859499-78859521 CGCTTGTGTGTCTGCCCAGTGGG + Intergenic
1043605320 8:81991917-81991939 TGCTTGTGTCCCTGCCTGCTAGG + Intergenic
1044085375 8:87936621-87936643 TGCTTGTGTCTCTGCCTGCTAGG + Intergenic
1044132362 8:88540014-88540036 GGCTTGTGACTCTGCCTTCTGGG + Intergenic
1044206175 8:89494148-89494170 TGCTTGTGTCTGTGCTGGCTAGG - Intergenic
1044462773 8:92465348-92465370 TTCTTGGGTTTCTGCATGCTTGG + Intergenic
1044765775 8:95572425-95572447 CACTTGTGTCTGTGCCTGCTAGG - Intergenic
1045538649 8:103059870-103059892 TGTGTGTGTGTGTGCGTGCTGGG - Intronic
1045546112 8:103130154-103130176 TGTTTGTGTGTGTGCGTGTTTGG + Intergenic
1045968551 8:108054395-108054417 TCTTTGTGTGTCTGCCACCTTGG - Intronic
1046138308 8:110060044-110060066 CACTTGTGTGCGTGCCTGCTAGG - Intergenic
1046142688 8:110115743-110115765 TGCTTGTGTGTCTAACTGCTAGG - Intergenic
1046250506 8:111624508-111624530 CACTTGTATGTCTGCCGGCTAGG + Intergenic
1046277480 8:111982494-111982516 TGCCTGTGTGACTGCCTGCTAGG + Intergenic
1046777294 8:118177886-118177908 TGCATGTGTGTCAGCCACCTGGG - Intergenic
1047229969 8:122988640-122988662 GACTTGTGTGTCTGCCTGTAAGG - Intergenic
1047542574 8:125784823-125784845 TGCCTGTATGTCAGCCTGCTAGG - Intergenic
1047640930 8:126821035-126821057 TGCCTGTGTATCTGCCTGCTAGG + Intergenic
1048135001 8:131739909-131739931 TGCTTGTGTGTCTGCCTGCTGGG - Intergenic
1048348140 8:133593673-133593695 TGCTTGTTTCCCTGCCTGCCAGG - Intergenic
1048531330 8:135253121-135253143 TGCTGATGTGGCTGCATGCTGGG - Intergenic
1048623419 8:136159308-136159330 CACTTGTGTCTGTGCCTGCTAGG + Intergenic
1049617156 8:143580671-143580693 TGCTGGTGTGGCTGGCTTCTTGG + Exonic
1049978887 9:885613-885635 CGCTTGTGTGTCTGCTCGCTAGG + Intronic
1050003839 9:1107133-1107155 TGTGTGTGTGTGTGCCTGCCAGG + Intergenic
1050202191 9:3157257-3157279 TGCTTGTGTGTCTGCCTGCTAGG + Intergenic
1051103609 9:13551139-13551161 AGCTTGTGTGTCTGCCTGCTAGG + Intergenic
1051144029 9:14007580-14007602 CACCTGTGTGTCTGCCGGCTAGG - Intergenic
1051887040 9:21904244-21904266 CGCCTGTGTATCTGCCTGCGAGG + Intronic
1051887170 9:21905307-21905329 TGCCTGTGTGTGTGCCCGCTAGG + Intronic
1051893554 9:21966474-21966496 CGCTTGTGTGTCTGCCTGCTAGG - Intronic
1052122672 9:24738015-24738037 CACCTGTGTGTCTGCCTGCTGGG - Intergenic
1052134922 9:24897864-24897886 CGCCTGTGTACCTGCCTGCTAGG - Intergenic
1053032907 9:34797695-34797717 AGCTTGTGTGTCTGCCTGCTAGG + Intergenic
1053178227 9:35945063-35945085 TGCTCTTGTGTCTGGCTGCTGGG + Intergenic
1053428033 9:38023860-38023882 CGCTTGTGTGTGTACCTGCATGG - Intronic
1054758097 9:68979404-68979426 TGCTTGTGTGTGTACATGTTGGG + Intronic
1054912373 9:70466151-70466173 TGCTTGTGTCTCTACCCACTAGG + Intergenic
1055168931 9:73230791-73230813 TGCTTGTTTGACTGTCTGTTTGG - Intergenic
1055251238 9:74308766-74308788 TGATTGTGTTTATGCCTTCTCGG + Intergenic
1055914512 9:81387180-81387202 TGCATGAGTGTGTACCTGCTAGG - Intergenic
1056377422 9:86028255-86028277 CGCTTGTGTGTGTGCCCGCTGGG - Intronic
1056685662 9:88757336-88757358 GGCTTGTGTTTGTGCCTCCTGGG + Intergenic
1057222646 9:93265756-93265778 CGCATGTGTGGCTTCCTGCTCGG - Intronic
1057446433 9:95118672-95118694 TTCTTTTGTGTCTGGCTTCTTGG + Intronic
1058206827 9:102118779-102118801 TGCTTGTGTCTCTGCCCTCTAGG + Intergenic
1058810625 9:108635360-108635382 TGGTTATGTGTGTGCCTGCCTGG + Intergenic
1059411595 9:114136000-114136022 TGCATGTGTGTGTGCATGTTGGG + Intergenic
1059945263 9:119403095-119403117 TGTGTGTGTGTGTGCCTGTTGGG + Intergenic
1060212519 9:121719279-121719301 TGCTTCTGTGCCTCTCTGCTGGG + Intronic
1060213088 9:121722375-121722397 TGTTTGGGTGTCTTCCTGTTCGG + Intronic
1061311930 9:129769302-129769324 TGCTTAAGTTTCTGCCCGCTGGG + Intergenic
1061393807 9:130332419-130332441 TGGTAGTGGGTCTGCCTGCCTGG + Intronic
1062116666 9:134813245-134813267 TGTGTGTGTGCCTGCATGCTGGG + Intronic
1062266911 9:135690721-135690743 GGCTTGTGTGTGTGTCTCCTCGG - Intergenic
1062557911 9:137124418-137124440 TGTGTGTCTGTCTGCCTCCTAGG - Intergenic
1203625205 Un_KI270750v1:11429-11451 TGCTTGTGTGTCTGCCTGCTAGG - Intergenic
1185837790 X:3361167-3361189 CACTTGTGTGTCTGCCTGCTAGG + Intergenic
1186297335 X:8164779-8164801 TGCTTTTGTGTCTGTTTGGTTGG - Intergenic
1186997797 X:15142236-15142258 TGCGTGTGTGTATGCGTGCATGG - Intergenic
1187138494 X:16570937-16570959 TGCTTGTGTCTCTGCCCACTAGG - Intergenic
1187248775 X:17578006-17578028 TGTTTGTGTGAGTGCCTGTTAGG + Intronic
1187260431 X:17680480-17680502 TGTTTGTGTGTGTGTATGCTGGG - Intronic
1187365342 X:18661855-18661877 CGCTTGTGTGTCTGCCTGCTAGG + Intronic
1187685958 X:21815653-21815675 TGTCTGTGTGTCTGTCTGTTGGG - Intergenic
1187885259 X:23883297-23883319 CGCTTGTGTGCCTGCCCGCTAGG - Intronic
1188224083 X:27575306-27575328 CACCTGTGTGTCTGCCTGCTAGG + Intergenic
1188622486 X:32243054-32243076 TGCCTGTCTGCCTGCTTGCTTGG - Intronic
1189959103 X:46307804-46307826 GGCTTGTGTCTCTGCCTGCGAGG + Intergenic
1190051905 X:47156817-47156839 TGCATGTCTGCTTGCCTGCTAGG + Intronic
1191109277 X:56792589-56792611 TGTGTGTGTGTGTGTCTGCTTGG - Intergenic
1191974934 X:66861497-66861519 CACTTGCGTGTGTGCCTGCTAGG + Intergenic
1192511429 X:71722660-71722682 TCCCTCTGTGTCTCCCTGCTGGG + Intergenic
1192515268 X:71758845-71758867 TCCCTCTGTGTCTCCCTGCTGGG - Intergenic
1192748527 X:73964010-73964032 TGCTTGTGTCTCTGCCTGCTAGG + Intergenic
1192804493 X:74497048-74497070 AGCTTGTGTGTGTGCCTGCTAGG + Intronic
1192927939 X:75776311-75776333 TGCTTGTGTGAATGCATGCATGG - Intergenic
1193135892 X:77970212-77970234 TGCTTGTATGTCTTCATACTTGG + Intronic
1193201665 X:78698434-78698456 TGCTGGTCTGACTCCCTGCTGGG + Intergenic
1193322007 X:80133884-80133906 TGCTTGTGTCTGCGCCTACTAGG - Intergenic
1193400520 X:81036872-81036894 TGCTTGTGTGTCTGCTTGTTAGG + Intergenic
1193607704 X:83588732-83588754 CACTGGTGTGTTTGCCTGCTAGG + Intergenic
1193702489 X:84780098-84780120 TGCCTGTGTGTCTGCCTGCTAGG + Intergenic
1193836373 X:86349372-86349394 TGCTTGTATCTCTGCCCGCTAGG + Intronic
1193898209 X:87140891-87140913 TGCCTGTGTGTCTGCCCGCTAGG - Intergenic
1194211316 X:91072604-91072626 CACCTGTGTGTCTGCCTGCTAGG + Intergenic
1194298257 X:92154608-92154630 CGCTTGTGTGTCTGCCCACTAGG - Intronic
1194463951 X:94208388-94208410 CCGCTGTGTGTCTGCCTGCTAGG - Intergenic
1195571022 X:106398910-106398932 ATCTTGTGTGTCAGACTGCTAGG + Intergenic
1195688123 X:107603449-107603471 TGAGTGTGTGTGTGTCTGCTGGG + Exonic
1195862744 X:109398910-109398932 CGCTGCTGTGTCTGCCTGCGTGG - Intronic
1196242019 X:113353179-113353201 AGCTTGTGTGTATGCCTGCTAGG - Intergenic
1196271384 X:113716152-113716174 CACTTGTGTGTGTGCCTGCTGGG - Intergenic
1196522980 X:116695611-116695633 CACTTGTGTCTGTGCCTGCTAGG - Intergenic
1197241461 X:124127194-124127216 TGCTTGTGTCTGTGCCCGCTAGG - Intronic
1197459578 X:126723917-126723939 TGCTTGTGTCTCTTCCCGCTTGG - Intergenic
1198167593 X:134072602-134072624 CGCTTGTGTGCCTGCCTGCTAGG + Intergenic
1198386642 X:136135211-136135233 CACTTGTGTGCCTGCCTGTTAGG + Intergenic
1198711373 X:139507939-139507961 TGCTTGTGTCTCTGCCCACTAGG - Intergenic
1198964238 X:142210530-142210552 CGCTTGTGTGTCTGCCTGCTAGG - Intergenic
1199069749 X:143462434-143462456 TGTTTGTGTCTGTGCCCGCTGGG - Intergenic
1199142658 X:144331644-144331666 TGCTTGTGTCTCTGCCTGCTAGG + Intergenic
1199267931 X:145849523-145849545 TGCCTCTGTATCTGCCTGCTAGG + Intergenic
1199506163 X:148563492-148563514 TGTGTGTGTGTGTGCATGCTGGG + Intronic
1199580093 X:149352044-149352066 TGCTTGTGCATGTGCCCGCTAGG + Intergenic
1199881965 X:151981054-151981076 TGCGTGTGTGTGTGCGTGTTGGG + Intergenic
1200615866 Y:5379568-5379590 CGCTTGTGTGTCTGCCCGCTAGG - Intronic
1200923081 Y:8630387-8630409 TGCTAGTGTCTCTCCCTGGTTGG - Intergenic