ID: 1011326353

View in Genome Browser
Species Human (GRCh38)
Location 6:86152793-86152815
Sequence TCTCAGGTTTCTATAGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011326346_1011326353 30 Left 1011326346 6:86152740-86152762 CCACTCATGTGTTCCTCAGAATG No data
Right 1011326353 6:86152793-86152815 TCTCAGGTTTCTATAGGCCCAGG No data
1011326348_1011326353 6 Left 1011326348 6:86152764-86152786 CCAGCTGCTTGTGTGTCTGCCTG 0: 9
1: 52
2: 79
3: 180
4: 539
Right 1011326353 6:86152793-86152815 TCTCAGGTTTCTATAGGCCCAGG No data
1011326347_1011326353 17 Left 1011326347 6:86152753-86152775 CCTCAGAATGTCCAGCTGCTTGT No data
Right 1011326353 6:86152793-86152815 TCTCAGGTTTCTATAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011326353 Original CRISPR TCTCAGGTTTCTATAGGCCC AGG Intergenic
No off target data available for this crispr