ID: 1011335474

View in Genome Browser
Species Human (GRCh38)
Location 6:86254865-86254887
Sequence CTGTGTGGCTGGAGAGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011335467_1011335474 16 Left 1011335467 6:86254826-86254848 CCTCTAGCTGGCACTTTATCTTC No data
Right 1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG No data
1011335469_1011335474 -6 Left 1011335469 6:86254848-86254870 CCACTGTGCCAAATGGACTGTGT No data
Right 1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG No data
1011335466_1011335474 27 Left 1011335466 6:86254815-86254837 CCACAGTTCTGCCTCTAGCTGGC No data
Right 1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011335474 Original CRISPR CTGTGTGGCTGGAGAGGAGA TGG Intergenic
No off target data available for this crispr