ID: 1011335879

View in Genome Browser
Species Human (GRCh38)
Location 6:86259273-86259295
Sequence TAGGAGCTGGAATCTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011335874_1011335879 -9 Left 1011335874 6:86259259-86259281 CCAACTCATACAGATAGGAGCTG No data
Right 1011335879 6:86259273-86259295 TAGGAGCTGGAATCTGGGCAGGG No data
1011335871_1011335879 21 Left 1011335871 6:86259229-86259251 CCATTGTGAAATCAGGTGCTCAT No data
Right 1011335879 6:86259273-86259295 TAGGAGCTGGAATCTGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011335879 Original CRISPR TAGGAGCTGGAATCTGGGCA GGG Intergenic
No off target data available for this crispr