ID: 1011339575

View in Genome Browser
Species Human (GRCh38)
Location 6:86298972-86298994
Sequence TGGAGTAAATGCAGAAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011339569_1011339575 16 Left 1011339569 6:86298933-86298955 CCATCTTTCTGTTCAATACAGAA No data
Right 1011339575 6:86298972-86298994 TGGAGTAAATGCAGAAGGGTGGG No data
1011339568_1011339575 29 Left 1011339568 6:86298920-86298942 CCAATATCAGTCTCCATCTTTCT No data
Right 1011339575 6:86298972-86298994 TGGAGTAAATGCAGAAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011339575 Original CRISPR TGGAGTAAATGCAGAAGGGT GGG Intergenic
No off target data available for this crispr