ID: 1011340977

View in Genome Browser
Species Human (GRCh38)
Location 6:86313836-86313858
Sequence GCCATTAGGCCCTAAATAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011340974_1011340977 9 Left 1011340974 6:86313804-86313826 CCTGGCAAGATTCATCACCTGCA No data
Right 1011340977 6:86313836-86313858 GCCATTAGGCCCTAAATAATTGG No data
1011340975_1011340977 -8 Left 1011340975 6:86313821-86313843 CCTGCAGACTAAAGAGCCATTAG No data
Right 1011340977 6:86313836-86313858 GCCATTAGGCCCTAAATAATTGG No data
1011340971_1011340977 30 Left 1011340971 6:86313783-86313805 CCTTAAAGGGAAGGACCTAGTCC No data
Right 1011340977 6:86313836-86313858 GCCATTAGGCCCTAAATAATTGG No data
1011340973_1011340977 15 Left 1011340973 6:86313798-86313820 CCTAGTCCTGGCAAGATTCATCA No data
Right 1011340977 6:86313836-86313858 GCCATTAGGCCCTAAATAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011340977 Original CRISPR GCCATTAGGCCCTAAATAAT TGG Intergenic
No off target data available for this crispr