ID: 1011341867

View in Genome Browser
Species Human (GRCh38)
Location 6:86324826-86324848
Sequence AAGCCCTTCTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011341867_1011341869 8 Left 1011341867 6:86324826-86324848 CCTTCACTCTTCTAGAAGGGCTT No data
Right 1011341869 6:86324857-86324879 AGGTTCTTTTTTCCATAGTTTGG No data
1011341867_1011341870 19 Left 1011341867 6:86324826-86324848 CCTTCACTCTTCTAGAAGGGCTT No data
Right 1011341870 6:86324868-86324890 TCCATAGTTTGGAGTAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011341867 Original CRISPR AAGCCCTTCTAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr