ID: 1011343918

View in Genome Browser
Species Human (GRCh38)
Location 6:86347910-86347932
Sequence TAATTCCCACACATTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8889
Summary {0: 5, 1: 91, 2: 975, 3: 2875, 4: 4943}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011343918_1011343923 6 Left 1011343918 6:86347910-86347932 CCTCCCACAATGTGTGGGAATTA 0: 5
1: 91
2: 975
3: 2875
4: 4943
Right 1011343923 6:86347939-86347961 CTAAAATTCAAGATGAGATTTGG 0: 170
1: 4810
2: 7902
3: 9705
4: 11080
1011343918_1011343925 10 Left 1011343918 6:86347910-86347932 CCTCCCACAATGTGTGGGAATTA 0: 5
1: 91
2: 975
3: 2875
4: 4943
Right 1011343925 6:86347943-86347965 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
1011343918_1011343924 7 Left 1011343918 6:86347910-86347932 CCTCCCACAATGTGTGGGAATTA 0: 5
1: 91
2: 975
3: 2875
4: 4943
Right 1011343924 6:86347940-86347962 TAAAATTCAAGATGAGATTTGGG 0: 310
1: 8150
2: 11221
3: 10437
4: 7573
1011343918_1011343926 11 Left 1011343918 6:86347910-86347932 CCTCCCACAATGTGTGGGAATTA 0: 5
1: 91
2: 975
3: 2875
4: 4943
Right 1011343926 6:86347944-86347966 ATTCAAGATGAGATTTGGGTGGG 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
1011343918_1011343927 12 Left 1011343918 6:86347910-86347932 CCTCCCACAATGTGTGGGAATTA 0: 5
1: 91
2: 975
3: 2875
4: 4943
Right 1011343927 6:86347945-86347967 TTCAAGATGAGATTTGGGTGGGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011343918 Original CRISPR TAATTCCCACACATTGTGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr