ID: 1011348768

View in Genome Browser
Species Human (GRCh38)
Location 6:86399978-86400000
Sequence CCATGTCCCAAGGTTGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011348757_1011348768 23 Left 1011348757 6:86399932-86399954 CCCCTTGGAACCGTAGCTGGAGC No data
Right 1011348768 6:86399978-86400000 CCATGTCCCAAGGTTGTGCAGGG No data
1011348759_1011348768 21 Left 1011348759 6:86399934-86399956 CCTTGGAACCGTAGCTGGAGCTG No data
Right 1011348768 6:86399978-86400000 CCATGTCCCAAGGTTGTGCAGGG No data
1011348761_1011348768 13 Left 1011348761 6:86399942-86399964 CCGTAGCTGGAGCTGGAATGTCT No data
Right 1011348768 6:86399978-86400000 CCATGTCCCAAGGTTGTGCAGGG No data
1011348758_1011348768 22 Left 1011348758 6:86399933-86399955 CCCTTGGAACCGTAGCTGGAGCT No data
Right 1011348768 6:86399978-86400000 CCATGTCCCAAGGTTGTGCAGGG No data
1011348755_1011348768 29 Left 1011348755 6:86399926-86399948 CCTGGGCCCCTTGGAACCGTAGC No data
Right 1011348768 6:86399978-86400000 CCATGTCCCAAGGTTGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011348768 Original CRISPR CCATGTCCCAAGGTTGTGCA GGG Intergenic
No off target data available for this crispr