ID: 1011359173

View in Genome Browser
Species Human (GRCh38)
Location 6:86503557-86503579
Sequence CCTACTCAATGATGTCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011359170_1011359173 -2 Left 1011359170 6:86503536-86503558 CCATTGGAGAAGTGCTAGTCACC No data
Right 1011359173 6:86503557-86503579 CCTACTCAATGATGTCCTGGTGG No data
1011359169_1011359173 2 Left 1011359169 6:86503532-86503554 CCTTCCATTGGAGAAGTGCTAGT No data
Right 1011359173 6:86503557-86503579 CCTACTCAATGATGTCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011359173 Original CRISPR CCTACTCAATGATGTCCTGG TGG Intergenic
No off target data available for this crispr