ID: 1011359812

View in Genome Browser
Species Human (GRCh38)
Location 6:86511358-86511380
Sequence TAATTGTGGGACTTTGCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011359812_1011359822 30 Left 1011359812 6:86511358-86511380 CCCAATGCAAAGTCCCACAATTA No data
Right 1011359822 6:86511411-86511433 ATTTCTCCACTCCACAGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011359812 Original CRISPR TAATTGTGGGACTTTGCATT GGG (reversed) Intergenic
No off target data available for this crispr