ID: 1011359813

View in Genome Browser
Species Human (GRCh38)
Location 6:86511359-86511381
Sequence GTAATTGTGGGACTTTGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011359813_1011359823 30 Left 1011359813 6:86511359-86511381 CCAATGCAAAGTCCCACAATTAC No data
Right 1011359823 6:86511412-86511434 TTTCTCCACTCCACAGCATAGGG No data
1011359813_1011359822 29 Left 1011359813 6:86511359-86511381 CCAATGCAAAGTCCCACAATTAC No data
Right 1011359822 6:86511411-86511433 ATTTCTCCACTCCACAGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011359813 Original CRISPR GTAATTGTGGGACTTTGCAT TGG (reversed) Intergenic
No off target data available for this crispr