ID: 1011359814

View in Genome Browser
Species Human (GRCh38)
Location 6:86511371-86511393
Sequence AGGGGGAGAACAGTAATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011359814_1011359823 18 Left 1011359814 6:86511371-86511393 CCCACAATTACTGTTCTCCCCCT No data
Right 1011359823 6:86511412-86511434 TTTCTCCACTCCACAGCATAGGG No data
1011359814_1011359827 30 Left 1011359814 6:86511371-86511393 CCCACAATTACTGTTCTCCCCCT No data
Right 1011359827 6:86511424-86511446 ACAGCATAGGGCTGCTGCCTGGG No data
1011359814_1011359822 17 Left 1011359814 6:86511371-86511393 CCCACAATTACTGTTCTCCCCCT No data
Right 1011359822 6:86511411-86511433 ATTTCTCCACTCCACAGCATAGG No data
1011359814_1011359826 29 Left 1011359814 6:86511371-86511393 CCCACAATTACTGTTCTCCCCCT No data
Right 1011359826 6:86511423-86511445 CACAGCATAGGGCTGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011359814 Original CRISPR AGGGGGAGAACAGTAATTGT GGG (reversed) Intergenic