ID: 1011359821

View in Genome Browser
Species Human (GRCh38)
Location 6:86511395-86511417
Sequence GAGAAATAATCTGTGTGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011359821_1011359828 7 Left 1011359821 6:86511395-86511417 CCAAAGCACACAGATTATTTCTC No data
Right 1011359828 6:86511425-86511447 CAGCATAGGGCTGCTGCCTGGGG No data
1011359821_1011359831 14 Left 1011359821 6:86511395-86511417 CCAAAGCACACAGATTATTTCTC No data
Right 1011359831 6:86511432-86511454 GGGCTGCTGCCTGGGGATTGGGG No data
1011359821_1011359826 5 Left 1011359821 6:86511395-86511417 CCAAAGCACACAGATTATTTCTC No data
Right 1011359826 6:86511423-86511445 CACAGCATAGGGCTGCTGCCTGG No data
1011359821_1011359823 -6 Left 1011359821 6:86511395-86511417 CCAAAGCACACAGATTATTTCTC No data
Right 1011359823 6:86511412-86511434 TTTCTCCACTCCACAGCATAGGG No data
1011359821_1011359834 17 Left 1011359821 6:86511395-86511417 CCAAAGCACACAGATTATTTCTC No data
Right 1011359834 6:86511435-86511457 CTGCTGCCTGGGGATTGGGGGGG No data
1011359821_1011359827 6 Left 1011359821 6:86511395-86511417 CCAAAGCACACAGATTATTTCTC No data
Right 1011359827 6:86511424-86511446 ACAGCATAGGGCTGCTGCCTGGG No data
1011359821_1011359829 12 Left 1011359821 6:86511395-86511417 CCAAAGCACACAGATTATTTCTC No data
Right 1011359829 6:86511430-86511452 TAGGGCTGCTGCCTGGGGATTGG No data
1011359821_1011359832 15 Left 1011359821 6:86511395-86511417 CCAAAGCACACAGATTATTTCTC No data
Right 1011359832 6:86511433-86511455 GGCTGCTGCCTGGGGATTGGGGG No data
1011359821_1011359833 16 Left 1011359821 6:86511395-86511417 CCAAAGCACACAGATTATTTCTC No data
Right 1011359833 6:86511434-86511456 GCTGCTGCCTGGGGATTGGGGGG No data
1011359821_1011359836 26 Left 1011359821 6:86511395-86511417 CCAAAGCACACAGATTATTTCTC No data
Right 1011359836 6:86511444-86511466 GGGGATTGGGGGGGTGCTACAGG No data
1011359821_1011359830 13 Left 1011359821 6:86511395-86511417 CCAAAGCACACAGATTATTTCTC No data
Right 1011359830 6:86511431-86511453 AGGGCTGCTGCCTGGGGATTGGG No data
1011359821_1011359822 -7 Left 1011359821 6:86511395-86511417 CCAAAGCACACAGATTATTTCTC No data
Right 1011359822 6:86511411-86511433 ATTTCTCCACTCCACAGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011359821 Original CRISPR GAGAAATAATCTGTGTGCTT TGG (reversed) Intergenic
No off target data available for this crispr