ID: 1011359823

View in Genome Browser
Species Human (GRCh38)
Location 6:86511412-86511434
Sequence TTTCTCCACTCCACAGCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011359815_1011359823 17 Left 1011359815 6:86511372-86511394 CCACAATTACTGTTCTCCCCCTC No data
Right 1011359823 6:86511412-86511434 TTTCTCCACTCCACAGCATAGGG No data
1011359816_1011359823 1 Left 1011359816 6:86511388-86511410 CCCCCTCCCAAAGCACACAGATT No data
Right 1011359823 6:86511412-86511434 TTTCTCCACTCCACAGCATAGGG No data
1011359820_1011359823 -5 Left 1011359820 6:86511394-86511416 CCCAAAGCACACAGATTATTTCT No data
Right 1011359823 6:86511412-86511434 TTTCTCCACTCCACAGCATAGGG No data
1011359817_1011359823 0 Left 1011359817 6:86511389-86511411 CCCCTCCCAAAGCACACAGATTA No data
Right 1011359823 6:86511412-86511434 TTTCTCCACTCCACAGCATAGGG No data
1011359821_1011359823 -6 Left 1011359821 6:86511395-86511417 CCAAAGCACACAGATTATTTCTC No data
Right 1011359823 6:86511412-86511434 TTTCTCCACTCCACAGCATAGGG No data
1011359818_1011359823 -1 Left 1011359818 6:86511390-86511412 CCCTCCCAAAGCACACAGATTAT No data
Right 1011359823 6:86511412-86511434 TTTCTCCACTCCACAGCATAGGG No data
1011359819_1011359823 -2 Left 1011359819 6:86511391-86511413 CCTCCCAAAGCACACAGATTATT No data
Right 1011359823 6:86511412-86511434 TTTCTCCACTCCACAGCATAGGG No data
1011359814_1011359823 18 Left 1011359814 6:86511371-86511393 CCCACAATTACTGTTCTCCCCCT No data
Right 1011359823 6:86511412-86511434 TTTCTCCACTCCACAGCATAGGG No data
1011359813_1011359823 30 Left 1011359813 6:86511359-86511381 CCAATGCAAAGTCCCACAATTAC No data
Right 1011359823 6:86511412-86511434 TTTCTCCACTCCACAGCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011359823 Original CRISPR TTTCTCCACTCCACAGCATA GGG Intergenic
No off target data available for this crispr