ID: 1011359826

View in Genome Browser
Species Human (GRCh38)
Location 6:86511423-86511445
Sequence CACAGCATAGGGCTGCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011359818_1011359826 10 Left 1011359818 6:86511390-86511412 CCCTCCCAAAGCACACAGATTAT No data
Right 1011359826 6:86511423-86511445 CACAGCATAGGGCTGCTGCCTGG No data
1011359816_1011359826 12 Left 1011359816 6:86511388-86511410 CCCCCTCCCAAAGCACACAGATT No data
Right 1011359826 6:86511423-86511445 CACAGCATAGGGCTGCTGCCTGG No data
1011359814_1011359826 29 Left 1011359814 6:86511371-86511393 CCCACAATTACTGTTCTCCCCCT No data
Right 1011359826 6:86511423-86511445 CACAGCATAGGGCTGCTGCCTGG No data
1011359817_1011359826 11 Left 1011359817 6:86511389-86511411 CCCCTCCCAAAGCACACAGATTA No data
Right 1011359826 6:86511423-86511445 CACAGCATAGGGCTGCTGCCTGG No data
1011359815_1011359826 28 Left 1011359815 6:86511372-86511394 CCACAATTACTGTTCTCCCCCTC No data
Right 1011359826 6:86511423-86511445 CACAGCATAGGGCTGCTGCCTGG No data
1011359821_1011359826 5 Left 1011359821 6:86511395-86511417 CCAAAGCACACAGATTATTTCTC No data
Right 1011359826 6:86511423-86511445 CACAGCATAGGGCTGCTGCCTGG No data
1011359820_1011359826 6 Left 1011359820 6:86511394-86511416 CCCAAAGCACACAGATTATTTCT No data
Right 1011359826 6:86511423-86511445 CACAGCATAGGGCTGCTGCCTGG No data
1011359819_1011359826 9 Left 1011359819 6:86511391-86511413 CCTCCCAAAGCACACAGATTATT No data
Right 1011359826 6:86511423-86511445 CACAGCATAGGGCTGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011359826 Original CRISPR CACAGCATAGGGCTGCTGCC TGG Intergenic
No off target data available for this crispr