ID: 1011360337

View in Genome Browser
Species Human (GRCh38)
Location 6:86517356-86517378
Sequence AAGGGGATGCATTATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011360337_1011360347 15 Left 1011360337 6:86517356-86517378 CCCTCCTCATAATGCATCCCCTT No data
Right 1011360347 6:86517394-86517416 CCCTCCATGTGCAACATCCTGGG No data
1011360337_1011360345 14 Left 1011360337 6:86517356-86517378 CCCTCCTCATAATGCATCCCCTT No data
Right 1011360345 6:86517393-86517415 TCCCTCCATGTGCAACATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011360337 Original CRISPR AAGGGGATGCATTATGAGGA GGG (reversed) Intergenic
No off target data available for this crispr