ID: 1011366610

View in Genome Browser
Species Human (GRCh38)
Location 6:86589016-86589038
Sequence TAGCCTCAACTGCTACCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011366610_1011366612 -5 Left 1011366610 6:86589016-86589038 CCTGTAGGTAGCAGTTGAGGCTA No data
Right 1011366612 6:86589034-86589056 GGCTAAACCTAATAAGTAAAGGG No data
1011366610_1011366613 0 Left 1011366610 6:86589016-86589038 CCTGTAGGTAGCAGTTGAGGCTA No data
Right 1011366613 6:86589039-86589061 AACCTAATAAGTAAAGGGATAGG No data
1011366610_1011366611 -6 Left 1011366610 6:86589016-86589038 CCTGTAGGTAGCAGTTGAGGCTA No data
Right 1011366611 6:86589033-86589055 AGGCTAAACCTAATAAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011366610 Original CRISPR TAGCCTCAACTGCTACCTAC AGG (reversed) Intergenic
No off target data available for this crispr