ID: 1011370618

View in Genome Browser
Species Human (GRCh38)
Location 6:86633460-86633482
Sequence TTGTAGTCAGAGACCCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011370616_1011370618 1 Left 1011370616 6:86633436-86633458 CCTCTGTCAGCTGGAGACTGGTT No data
Right 1011370618 6:86633460-86633482 TTGTAGTCAGAGACCCTGGTAGG No data
1011370612_1011370618 17 Left 1011370612 6:86633420-86633442 CCAGGGAGGCCTGAAACCTCTGT 0: 3
1: 9
2: 16
3: 42
4: 297
Right 1011370618 6:86633460-86633482 TTGTAGTCAGAGACCCTGGTAGG No data
1011370614_1011370618 8 Left 1011370614 6:86633429-86633451 CCTGAAACCTCTGTCAGCTGGAG 0: 3
1: 8
2: 8
3: 41
4: 252
Right 1011370618 6:86633460-86633482 TTGTAGTCAGAGACCCTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011370618 Original CRISPR TTGTAGTCAGAGACCCTGGT AGG Intergenic
No off target data available for this crispr