ID: 1011370844

View in Genome Browser
Species Human (GRCh38)
Location 6:86634747-86634769
Sequence TGTTAGCAGAGCAGCCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011370844_1011370850 23 Left 1011370844 6:86634747-86634769 CCTGAGAGGCTGCTCTGCTAACA No data
Right 1011370850 6:86634793-86634815 ACTGAAGACTCTAGTGGAATGGG No data
1011370844_1011370848 17 Left 1011370844 6:86634747-86634769 CCTGAGAGGCTGCTCTGCTAACA No data
Right 1011370848 6:86634787-86634809 TGTCAGACTGAAGACTCTAGTGG No data
1011370844_1011370849 22 Left 1011370844 6:86634747-86634769 CCTGAGAGGCTGCTCTGCTAACA No data
Right 1011370849 6:86634792-86634814 GACTGAAGACTCTAGTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011370844 Original CRISPR TGTTAGCAGAGCAGCCTCTC AGG (reversed) Intergenic