ID: 1011370845

View in Genome Browser
Species Human (GRCh38)
Location 6:86634770-86634792
Sequence CTGACACACAGAGCTACGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011370845_1011370852 10 Left 1011370845 6:86634770-86634792 CCCCACGTAGCTCTGTGTGTCAG No data
Right 1011370852 6:86634803-86634825 CTAGTGGAATGGGTTCACAAGGG No data
1011370845_1011370851 9 Left 1011370845 6:86634770-86634792 CCCCACGTAGCTCTGTGTGTCAG No data
Right 1011370851 6:86634802-86634824 TCTAGTGGAATGGGTTCACAAGG No data
1011370845_1011370849 -1 Left 1011370845 6:86634770-86634792 CCCCACGTAGCTCTGTGTGTCAG No data
Right 1011370849 6:86634792-86634814 GACTGAAGACTCTAGTGGAATGG No data
1011370845_1011370850 0 Left 1011370845 6:86634770-86634792 CCCCACGTAGCTCTGTGTGTCAG No data
Right 1011370850 6:86634793-86634815 ACTGAAGACTCTAGTGGAATGGG No data
1011370845_1011370848 -6 Left 1011370845 6:86634770-86634792 CCCCACGTAGCTCTGTGTGTCAG No data
Right 1011370848 6:86634787-86634809 TGTCAGACTGAAGACTCTAGTGG No data
1011370845_1011370854 28 Left 1011370845 6:86634770-86634792 CCCCACGTAGCTCTGTGTGTCAG No data
Right 1011370854 6:86634821-86634843 AAGGGGATCTTCTGACCTGAAGG No data
1011370845_1011370853 11 Left 1011370845 6:86634770-86634792 CCCCACGTAGCTCTGTGTGTCAG No data
Right 1011370853 6:86634804-86634826 TAGTGGAATGGGTTCACAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011370845 Original CRISPR CTGACACACAGAGCTACGTG GGG (reversed) Intergenic