ID: 1011370846

View in Genome Browser
Species Human (GRCh38)
Location 6:86634771-86634793
Sequence TCTGACACACAGAGCTACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011370846_1011370853 10 Left 1011370846 6:86634771-86634793 CCCACGTAGCTCTGTGTGTCAGA No data
Right 1011370853 6:86634804-86634826 TAGTGGAATGGGTTCACAAGGGG No data
1011370846_1011370850 -1 Left 1011370846 6:86634771-86634793 CCCACGTAGCTCTGTGTGTCAGA No data
Right 1011370850 6:86634793-86634815 ACTGAAGACTCTAGTGGAATGGG No data
1011370846_1011370849 -2 Left 1011370846 6:86634771-86634793 CCCACGTAGCTCTGTGTGTCAGA No data
Right 1011370849 6:86634792-86634814 GACTGAAGACTCTAGTGGAATGG No data
1011370846_1011370851 8 Left 1011370846 6:86634771-86634793 CCCACGTAGCTCTGTGTGTCAGA No data
Right 1011370851 6:86634802-86634824 TCTAGTGGAATGGGTTCACAAGG No data
1011370846_1011370854 27 Left 1011370846 6:86634771-86634793 CCCACGTAGCTCTGTGTGTCAGA No data
Right 1011370854 6:86634821-86634843 AAGGGGATCTTCTGACCTGAAGG No data
1011370846_1011370852 9 Left 1011370846 6:86634771-86634793 CCCACGTAGCTCTGTGTGTCAGA No data
Right 1011370852 6:86634803-86634825 CTAGTGGAATGGGTTCACAAGGG No data
1011370846_1011370848 -7 Left 1011370846 6:86634771-86634793 CCCACGTAGCTCTGTGTGTCAGA No data
Right 1011370848 6:86634787-86634809 TGTCAGACTGAAGACTCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011370846 Original CRISPR TCTGACACACAGAGCTACGT GGG (reversed) Intergenic
No off target data available for this crispr