ID: 1011370850

View in Genome Browser
Species Human (GRCh38)
Location 6:86634793-86634815
Sequence ACTGAAGACTCTAGTGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011370847_1011370850 -2 Left 1011370847 6:86634772-86634794 CCACGTAGCTCTGTGTGTCAGAC No data
Right 1011370850 6:86634793-86634815 ACTGAAGACTCTAGTGGAATGGG No data
1011370846_1011370850 -1 Left 1011370846 6:86634771-86634793 CCCACGTAGCTCTGTGTGTCAGA No data
Right 1011370850 6:86634793-86634815 ACTGAAGACTCTAGTGGAATGGG No data
1011370844_1011370850 23 Left 1011370844 6:86634747-86634769 CCTGAGAGGCTGCTCTGCTAACA No data
Right 1011370850 6:86634793-86634815 ACTGAAGACTCTAGTGGAATGGG No data
1011370845_1011370850 0 Left 1011370845 6:86634770-86634792 CCCCACGTAGCTCTGTGTGTCAG No data
Right 1011370850 6:86634793-86634815 ACTGAAGACTCTAGTGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011370850 Original CRISPR ACTGAAGACTCTAGTGGAAT GGG Intergenic