ID: 1011371428

View in Genome Browser
Species Human (GRCh38)
Location 6:86640986-86641008
Sequence ATGTGTGCTGGGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011371415_1011371428 30 Left 1011371415 6:86640933-86640955 CCTAGGTGCTTTCTCACCATGTC No data
Right 1011371428 6:86640986-86641008 ATGTGTGCTGGGAAGGTGGAGGG No data
1011371419_1011371428 6 Left 1011371419 6:86640957-86640979 CCATAAACCAGGGTCTTCCCAGT No data
Right 1011371428 6:86640986-86641008 ATGTGTGCTGGGAAGGTGGAGGG No data
1011371418_1011371428 14 Left 1011371418 6:86640949-86640971 CCATGTCTCCATAAACCAGGGTC No data
Right 1011371428 6:86640986-86641008 ATGTGTGCTGGGAAGGTGGAGGG No data
1011371420_1011371428 -1 Left 1011371420 6:86640964-86640986 CCAGGGTCTTCCCAGTCAGAACA No data
Right 1011371428 6:86640986-86641008 ATGTGTGCTGGGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011371428 Original CRISPR ATGTGTGCTGGGAAGGTGGA GGG Intergenic
No off target data available for this crispr