ID: 1011377284

View in Genome Browser
Species Human (GRCh38)
Location 6:86703127-86703149
Sequence TTGAATAAGAATGAAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011377281_1011377284 3 Left 1011377281 6:86703101-86703123 CCGTAGCCAGAACTTCCAGTACT No data
Right 1011377284 6:86703127-86703149 TTGAATAAGAATGAAGAGAGAGG No data
1011377282_1011377284 -3 Left 1011377282 6:86703107-86703129 CCAGAACTTCCAGTACTATGTTG 0: 109
1: 2241
2: 11212
3: 4458
4: 1744
Right 1011377284 6:86703127-86703149 TTGAATAAGAATGAAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011377284 Original CRISPR TTGAATAAGAATGAAGAGAG AGG Intergenic
No off target data available for this crispr