ID: 1011381024

View in Genome Browser
Species Human (GRCh38)
Location 6:86742366-86742388
Sequence GTCCTGAGGGTGCTTAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011381024_1011381029 1 Left 1011381024 6:86742366-86742388 CCTTGATTAAGCACCCTCAGGAC No data
Right 1011381029 6:86742390-86742412 CAATCTCACACATATACGCATGG No data
1011381024_1011381030 21 Left 1011381024 6:86742366-86742388 CCTTGATTAAGCACCCTCAGGAC No data
Right 1011381030 6:86742410-86742432 TGGCTCCTGCCAGAACATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011381024 Original CRISPR GTCCTGAGGGTGCTTAATCA AGG (reversed) Intergenic
No off target data available for this crispr