ID: 1011381025

View in Genome Browser
Species Human (GRCh38)
Location 6:86742379-86742401
Sequence TGTGTGAGATTGGGTCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011381025_1011381034 30 Left 1011381025 6:86742379-86742401 CCCTCAGGACCCAATCTCACACA No data
Right 1011381034 6:86742432-86742454 GCTAGATCTTTATCTCCTCTGGG No data
1011381025_1011381033 29 Left 1011381025 6:86742379-86742401 CCCTCAGGACCCAATCTCACACA No data
Right 1011381033 6:86742431-86742453 GGCTAGATCTTTATCTCCTCTGG No data
1011381025_1011381030 8 Left 1011381025 6:86742379-86742401 CCCTCAGGACCCAATCTCACACA No data
Right 1011381030 6:86742410-86742432 TGGCTCCTGCCAGAACATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011381025 Original CRISPR TGTGTGAGATTGGGTCCTGA GGG (reversed) Intergenic
No off target data available for this crispr