ID: 1011381026

View in Genome Browser
Species Human (GRCh38)
Location 6:86742380-86742402
Sequence ATGTGTGAGATTGGGTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011381026_1011381030 7 Left 1011381026 6:86742380-86742402 CCTCAGGACCCAATCTCACACAT No data
Right 1011381030 6:86742410-86742432 TGGCTCCTGCCAGAACATGCTGG No data
1011381026_1011381033 28 Left 1011381026 6:86742380-86742402 CCTCAGGACCCAATCTCACACAT No data
Right 1011381033 6:86742431-86742453 GGCTAGATCTTTATCTCCTCTGG No data
1011381026_1011381035 30 Left 1011381026 6:86742380-86742402 CCTCAGGACCCAATCTCACACAT No data
Right 1011381035 6:86742433-86742455 CTAGATCTTTATCTCCTCTGGGG No data
1011381026_1011381034 29 Left 1011381026 6:86742380-86742402 CCTCAGGACCCAATCTCACACAT No data
Right 1011381034 6:86742432-86742454 GCTAGATCTTTATCTCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011381026 Original CRISPR ATGTGTGAGATTGGGTCCTG AGG (reversed) Intergenic
No off target data available for this crispr