ID: 1011381030

View in Genome Browser
Species Human (GRCh38)
Location 6:86742410-86742432
Sequence TGGCTCCTGCCAGAACATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011381024_1011381030 21 Left 1011381024 6:86742366-86742388 CCTTGATTAAGCACCCTCAGGAC No data
Right 1011381030 6:86742410-86742432 TGGCTCCTGCCAGAACATGCTGG No data
1011381026_1011381030 7 Left 1011381026 6:86742380-86742402 CCTCAGGACCCAATCTCACACAT No data
Right 1011381030 6:86742410-86742432 TGGCTCCTGCCAGAACATGCTGG No data
1011381028_1011381030 -2 Left 1011381028 6:86742389-86742411 CCAATCTCACACATATACGCATG No data
Right 1011381030 6:86742410-86742432 TGGCTCCTGCCAGAACATGCTGG No data
1011381027_1011381030 -1 Left 1011381027 6:86742388-86742410 CCCAATCTCACACATATACGCAT No data
Right 1011381030 6:86742410-86742432 TGGCTCCTGCCAGAACATGCTGG No data
1011381025_1011381030 8 Left 1011381025 6:86742379-86742401 CCCTCAGGACCCAATCTCACACA No data
Right 1011381030 6:86742410-86742432 TGGCTCCTGCCAGAACATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011381030 Original CRISPR TGGCTCCTGCCAGAACATGC TGG Intergenic
No off target data available for this crispr