ID: 1011381708

View in Genome Browser
Species Human (GRCh38)
Location 6:86749184-86749206
Sequence GATTTCTAATGGAGCTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011381705_1011381708 -4 Left 1011381705 6:86749165-86749187 CCATTTATAAGCAAAGATTGATT No data
Right 1011381708 6:86749184-86749206 GATTTCTAATGGAGCTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011381708 Original CRISPR GATTTCTAATGGAGCTTAGG AGG Intergenic
No off target data available for this crispr