ID: 1011383308

View in Genome Browser
Species Human (GRCh38)
Location 6:86766421-86766443
Sequence GCCACCTAGACAATAACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011383305_1011383308 21 Left 1011383305 6:86766377-86766399 CCAAAAGCACCACACTTCTTTGC No data
Right 1011383308 6:86766421-86766443 GCCACCTAGACAATAACCCAAGG No data
1011383307_1011383308 12 Left 1011383307 6:86766386-86766408 CCACACTTCTTTGCAAGGAGAGC No data
Right 1011383308 6:86766421-86766443 GCCACCTAGACAATAACCCAAGG No data
1011383303_1011383308 29 Left 1011383303 6:86766369-86766391 CCCAGCATCCAAAAGCACCACAC No data
Right 1011383308 6:86766421-86766443 GCCACCTAGACAATAACCCAAGG No data
1011383304_1011383308 28 Left 1011383304 6:86766370-86766392 CCAGCATCCAAAAGCACCACACT No data
Right 1011383308 6:86766421-86766443 GCCACCTAGACAATAACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011383308 Original CRISPR GCCACCTAGACAATAACCCA AGG Intergenic
No off target data available for this crispr