ID: 1011383687

View in Genome Browser
Species Human (GRCh38)
Location 6:86770297-86770319
Sequence TTTTTATCATGAAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011383687_1011383692 2 Left 1011383687 6:86770297-86770319 CCATCTTCCCTTCATGATAAAAA No data
Right 1011383692 6:86770322-86770344 TCCTAGGAACAAGGCATCAGTGG No data
1011383687_1011383691 -7 Left 1011383687 6:86770297-86770319 CCATCTTCCCTTCATGATAAAAA No data
Right 1011383691 6:86770313-86770335 ATAAAAACATCCTAGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011383687 Original CRISPR TTTTTATCATGAAGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr