ID: 1011384573

View in Genome Browser
Species Human (GRCh38)
Location 6:86781287-86781309
Sequence CTGTGTTAACAGAAGCATAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011384573_1011384574 0 Left 1011384573 6:86781287-86781309 CCGCTATGCTTCTGTTAACACAG No data
Right 1011384574 6:86781310-86781332 CTTTGCAGAATATGTTTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011384573 Original CRISPR CTGTGTTAACAGAAGCATAG CGG (reversed) Intergenic
No off target data available for this crispr