ID: 1011386192

View in Genome Browser
Species Human (GRCh38)
Location 6:86801369-86801391
Sequence TGCCCACTATAACCACTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011386189_1011386192 3 Left 1011386189 6:86801343-86801365 CCACTACAGCACTGGGCCTCAAC No data
Right 1011386192 6:86801369-86801391 TGCCCACTATAACCACTAACTGG No data
1011386187_1011386192 10 Left 1011386187 6:86801336-86801358 CCTGAAGCCACTACAGCACTGGG No data
Right 1011386192 6:86801369-86801391 TGCCCACTATAACCACTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011386192 Original CRISPR TGCCCACTATAACCACTAAC TGG Intergenic
No off target data available for this crispr