ID: 1011391111

View in Genome Browser
Species Human (GRCh38)
Location 6:86854726-86854748
Sequence AGATGGAGCCTTCAACTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011391111_1011391119 10 Left 1011391111 6:86854726-86854748 CCCCCAAGTTGAAGGCTCCATCT No data
Right 1011391119 6:86854759-86854781 CCCTCTCCACACACACACACTGG No data
1011391111_1011391122 23 Left 1011391111 6:86854726-86854748 CCCCCAAGTTGAAGGCTCCATCT No data
Right 1011391122 6:86854772-86854794 CACACACTGGTCCCAAGTCCCGG No data
1011391111_1011391123 30 Left 1011391111 6:86854726-86854748 CCCCCAAGTTGAAGGCTCCATCT No data
Right 1011391123 6:86854779-86854801 TGGTCCCAAGTCCCGGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011391111 Original CRISPR AGATGGAGCCTTCAACTTGG GGG (reversed) Intergenic
No off target data available for this crispr