ID: 1011391207

View in Genome Browser
Species Human (GRCh38)
Location 6:86855273-86855295
Sequence GTGTTATGGGCCAGGAACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011391197_1011391207 15 Left 1011391197 6:86855235-86855257 CCAACATTATAACGCAAAAGACT No data
Right 1011391207 6:86855273-86855295 GTGTTATGGGCCAGGAACTGGGG No data
1011391195_1011391207 25 Left 1011391195 6:86855225-86855247 CCTGACATACCCAACATTATAAC No data
Right 1011391207 6:86855273-86855295 GTGTTATGGGCCAGGAACTGGGG No data
1011391196_1011391207 16 Left 1011391196 6:86855234-86855256 CCCAACATTATAACGCAAAAGAC No data
Right 1011391207 6:86855273-86855295 GTGTTATGGGCCAGGAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011391207 Original CRISPR GTGTTATGGGCCAGGAACTG GGG Intergenic